Morpholino

MO3-pkd2

ID
ZDB-MRPHLNO-060630-4
Name
MO3-pkd2
Previous Names
  • hi4166 oligo 1 (1)
  • pkd2ATGMO (1)
Target
Sequence
5' - AGGACGAACGCGACTGGAGCTCATC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-pkd2
No data available
Phenotype
Phenotype resulting from MO3-pkd2
Phenotype Fish Figures
artery cilium decreased length, abnormal AB + MO3-pkd2 Fig. S14 from Pala et al., 2019
blood vessel decreased diameter, abnormal AB + MO3-pkd2 Fig. S13 from Pala et al., 2019
blood vessel cilium decreased amount, abnormal hsc5Tg; pku6Tg + MO3-pkd2 Fig. 2 with image from Liu et al., 2019
blood vessel cilium decreased length, abnormal hsc5Tg; pku6Tg + MO3-pkd2 Fig. 2 with image from Liu et al., 2019
brain hydrocephalic, abnormal WT + MO3-pkd2 Fig. 6 from Sussman et al., 2014
Fig. 9 with image from Rothschild et al., 2011
Fig. 8 from Giamarchi et al., 2010
Fig. 4 from Feng et al., 2008
calcium/calmodulin-dependent protein kinase activity decreased occurrence, abnormal zf34Tg + MO3-pkd2 Fig. 8 with image from Rothschild et al., 2011
calcium/calmodulin-dependent protein kinase activity decreased rate, abnormal WT + MO3-pkd2 Fig. 7 with image from Francescatto et al., 2010
cell proliferation involved in pronephros development increased occurrence, abnormal WT + MO3-pkd2 Fig. 4 from Chang et al., 2011
cloacal chamber cilium decreased amount, abnormal WT + MO3-pkd2 Fig. 9 with image from Rothschild et al., 2011
cloacal chamber cilium decreased length, abnormal WT + MO3-pkd2 Fig. 9 with image from Rothschild et al., 2011
determination of heart left/right asymmetry disrupted, abnormal WT + MO3-pkd2 Fig. 8 from Giamarchi et al., 2010
determination of left/right symmetry process quality, abnormal WT + MO3-pkd2 text only from Fogelgren et al., 2011
gut edematous, abnormal WT + MO3-pkd2 Fig. S1 from Chang et al., 2011
head hydrocephalic, abnormal WT + MO3-pkd2 Fig. 4 from Sun et al., 2019
heart decreased functionality, abnormal AB + MO3-pkd2 Fig. S13 from Pala et al., 2019
heart edematous, abnormal WT + MO3-pkd2 Fig. 8 from Giamarchi et al., 2010
heart mislocalised, abnormal WT + MO3-pkd2 Fig. 8 from Giamarchi et al., 2010
heart cilium decreased length, abnormal AB + MO3-pkd2 Fig. S14 from Pala et al., 2019
heart looping disrupted, abnormal WT + MO3-pkd2 Fig. 8 from Giamarchi et al., 2010
heart looping process quality, abnormal twu34Tg + MO3-pkd2 Fig. 7 from Hurd et al., 2010
hematopoietic progenitor cell differentiation decreased occurrence, abnormal AB + MO3-pkd2 Fig. 3 with imageFig. 5 with image from Liu et al., 2019
hypoblast calcium-mediated signaling process quality, abnormal WT + MO3-pkd2 Fig. 4 with image from Yuan et al., 2015
inner ear posterior-most region increased distance pronephric duct anterior-most region, abnormal WT + MO3-pkd2 Fig. 9 with image from Rothschild et al., 2011
kidney cystic, abnormal AB + MO3-pkd2 Fig. S13 from Pala et al., 2019
Kupffer's vesicle calcium-mediated signaling process quality, abnormal WT + MO3-pkd2 Fig. 2 with image from Yuan et al., 2015
pericardium edematous, abnormal TL + MO3-pkd2 Fig. 7 from Verschuren et al., 2020
post-vent region curled, abnormal AB + MO3-pkd2 Fig. 4 with image from Zheng et al., 2018
post-vent region curved, abnormal AB + MO3-pkd2 Fig. 7 from Verschuren et al., 2020
Fig. S13 from Pala et al., 2019
Fig. 6 from Zheng et al., 2016
Fig. 8 from Aboualaiwi et al., 2014
Fig. 4 with image from Fogelgren et al., 2011
post-vent region curved dorsal, abnormal li1Tg + MO3-pkd2 Fig. 2 with image from Chang et al., 2017
Fig. 6 with image from Arif Pavel et al., 2016
Fig. 9 with image from Rothschild et al., 2011
Fig. 1 from Yuan et al., 2009
post-vent region increased curvature, abnormal WT + MO3-pkd2 Fig. 6 with image from Arif Pavel et al., 2016
Fig. 1 with imageTable 2 from Sun et al., 2004
pronephric duct cystic, abnormal TU + MO3-pkd2 Fig. 2Fig. 5Fig. 7 from Xu et al., 2018
Fig. 2 from Chang et al., 2011
pronephric duct Ab6-map1lc3b labeling decreased amount, abnormal li1Tg + MO3-pkd2 Fig. 7 with image from Chang et al., 2017
pronephric duct Ab2-scrib labeling decreased amount, abnormal TU + MO3-pkd2 Fig. 1 from Xu et al., 2018
pronephric duct Ab6-map1lc3b labeling decreased distribution, abnormal li1Tg + MO3-pkd2 Fig. 7 with image from Chang et al., 2017
pronephric duct anatomical region has extra parts of type leukocyte, abnormal WT + MO3-pkd2 Fig. 4 with image from Chang et al., 2017
pronephric duct autophagy decreased occurrence, abnormal li1Tg + MO3-pkd2 Fig. 7 with image from Chang et al., 2017
pronephric duct distal region obstructed, abnormal WT + MO3-pkd2 Fig. 9 with image from Rothschild et al., 2011
pronephric duct epithelial cell proliferation increased occurrence, abnormal WT + MO3-pkd2 Fig. 3 with image from Chang et al., 2017
pronephric glomerulus cystic, abnormal li1Tg + MO3-pkd2 Fig. 8 with image from Arhatte et al., 2019
Fig. 6 with image from Arif Pavel et al., 2016
pronephric glomerulus dilated, abnormal li1Tg + MO3-pkd2 Fig. 6 with image from Arif Pavel et al., 2016
Fig. 2 from Chang et al., 2011
pronephric glomerulus increased diameter, abnormal li1Tg + MO3-pkd2 Fig. 8 with image from Arhatte et al., 2019
pronephric glomerulus EGFP expression increased distribution, abnormal li1Tg + MO3-pkd2 Fig. 6 with image from Arif Pavel et al., 2016
pronephric glomerulus increased size, abnormal WT + MO3-pkd2 Fig. 8 with image from Sullivan-Brown et al., 2008
pronephric tubule dilated, abnormal li1Tg + MO3-pkd2 Fig. 4 with image from Zheng et al., 2018
Fig. 7 from Zheng et al., 2016
Fig. 2 from Chang et al., 2011
pronephros cystic, abnormal AB + MO3-pkd2 FIGURE 4 with image from Chen et al., 2021
Fig. 7 from Verschuren et al., 2020
Fig. 4 from Sun et al., 2019
Fig. 4 with image from Zheng et al., 2018
Fig. 1 with imageFig. 7 with image from Chang et al., 2017
Fig. 7 from Zheng et al., 2016
Fig. 8 from Aboualaiwi et al., 2014
Fig. 6 from Sussman et al., 2014
Fig. 8 from Giamarchi et al., 2010
Fig. 1 with image from Cao et al., 2009
Fig. 4 from Feng et al., 2008
Fig. 1 with imageTable 2 from Sun et al., 2004
pronephros anterior region structure, abnormal WT + MO3-pkd2 Fig. 9 with image from Rothschild et al., 2011
pronephros anterior region truncated, abnormal WT + MO3-pkd2 Fig. 9 with image from Rothschild et al., 2011
pronephros morphogenesis decreased process quality, abnormal WT + MO3-pkd2 Fig. 1 with imageFig. 3 with imageFig. 4 with imageFig. 7 with image from Chang et al., 2017
protein autophosphorylation decreased occurrence, abnormal WT + MO3-pkd2 Fig. 7 with image from Francescatto et al., 2010
trunk curved dorsal, abnormal WT + MO3-pkd2 Fig. 3 from Bouvrette et al., 2010
trunk increased curvature, abnormal WT + MO3-pkd2 Fig. 6 from Sussman et al., 2014
vent malformed, abnormal li1Tg + MO3-pkd2 Fig. 2 with image from Chang et al., 2017
ventral wall of dorsal aorta runx1 expression decreased amount, abnormal pkd2ouc2015/ouc2015 + MO3-pkd2 Fig. 3 with imageFig. 5 with image from Liu et al., 2019
ventral wall of dorsal aorta myb expression decreased amount, abnormal AB + MO3-pkd2 Fig. 3 with image from Liu et al., 2019
ventral wall of dorsal aorta runx1 expression decreased distribution, abnormal pkd2ouc2015/ouc2015 + MO3-pkd2 Fig. 3 with imageFig. 5 with image from Liu et al., 2019
ventral wall of dorsal aorta myb expression decreased distribution, abnormal AB + MO3-pkd2 Fig. 3 with image from Liu et al., 2019
ventral wall of dorsal aorta endothelial cell mCherry expression decreased amount, abnormal jh11Tg; y1Tg + MO3-pkd2 Fig. 6 with image from Liu et al., 2019
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell decreased amount, abnormal AB + MO3-pkd2 Fig. 5 with image from Liu et al., 2019
whole organism curved dorsal, abnormal WT + MO3-pkd2 Fig. 4 from Sun et al., 2019
Fig. 1 with image from Cao et al., 2009
whole organism Ab2-lats1 labeling decreased amount, abnormal TU + MO3-pkd2 Fig. 5 from Xu et al., 2018
whole organism Ab3-lats1 labeling decreased amount, abnormal TU + MO3-pkd2 Fig. 5 from Xu et al., 2018
whole organism Ab3-yap1 labeling decreased amount, abnormal TU + MO3-pkd2 Fig. 5 from Xu et al., 2018
whole organism dcn expression decreased amount, abnormal WT + MO3-pkd2 Fig. 6 from Liu et al., 2019
whole organism Ab2-scrib labeling decreased amount, abnormal TU + MO3-pkd2 Fig. 1 from Xu et al., 2018
whole organism decreased life span, abnormal TL + MO3-pkd2 Fig. 7 from Verschuren et al., 2020
whole organism ccn1 expression increased amount, abnormal TU + MO3-pkd2 Fig. 5 from Xu et al., 2018
whole organism ccn2a expression increased amount, abnormal TU + MO3-pkd2 Fig. 5 from Xu et al., 2018
whole organism increased curvature, abnormal WT + MO3-pkd2 Fig. 8 from Giamarchi et al., 2010
Fig. 4 from Feng et al., 2008
whole organism chromosome increased amount, abnormal AB + MO3-pkd2 Fig. 8 from Aboualaiwi et al., 2014
Phenotype of all Fish created by or utilizing MO3-pkd2
Phenotype Fish Conditions Figures
ventral wall of dorsal aorta runx1 expression decreased amount, abnormal pkd2ouc2015/ouc2015 + MO3-pkd2 control Fig. 3 with image from Liu et al., 2019
ventral wall of dorsal aorta runx1 expression decreased distribution, abnormal pkd2ouc2015/ouc2015 + MO3-pkd2 control Fig. 3 with image from Liu et al., 2019
hematopoietic progenitor cell differentiation decreased occurrence, abnormal pkd2ouc2015/ouc2015 + MO3-pkd2 control Fig. 3 with image from Liu et al., 2019
whole organism chromosome increased amount, abnormal AB + MO3-pkd2 standard conditions Fig. 8 from Aboualaiwi et al., 2014
brain hydrocephalic, abnormal AB + MO3-pkd2 standard conditions Fig. 4 from Feng et al., 2008
whole organism increased curvature, abnormal AB + MO3-pkd2 standard conditions Fig. 4 from Feng et al., 2008
ventral wall of dorsal aorta myb expression decreased distribution, abnormal AB + MO3-pkd2 control Fig. 3 with image from Liu et al., 2019
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell decreased amount, abnormal AB + MO3-pkd2 control Fig. 5 with image from Liu et al., 2019
post-vent region curved, abnormal AB + MO3-pkd2 standard conditions Fig. S13 from Pala et al., 2019
Fig. 6 from Zheng et al., 2016
Fig. 8 from Aboualaiwi et al., 2014
heart cilium decreased length, abnormal AB + MO3-pkd2 standard conditions Fig. S14 from Pala et al., 2019
ventral wall of dorsal aorta runx1 expression decreased distribution, abnormal AB + MO3-pkd2 control Fig. 3 with imageFig. 5 with image from Liu et al., 2019
pronephric tubule dilated, abnormal AB + MO3-pkd2 standard conditions Fig. 4 with image from Zheng et al., 2018
Fig. 7 from Zheng et al., 2016
hematopoietic progenitor cell differentiation decreased occurrence, abnormal AB + MO3-pkd2 control Fig. 3 with imageFig. 5 with image from Liu et al., 2019
kidney cystic, abnormal AB + MO3-pkd2 standard conditions Fig. S13 from Pala et al., 2019
artery cilium decreased length, abnormal AB + MO3-pkd2 standard conditions Fig. S14 from Pala et al., 2019
post-vent region curled, abnormal AB + MO3-pkd2 standard conditions Fig. 4 with image from Zheng et al., 2018
pronephros cystic, abnormal AB + MO3-pkd2 standard conditions Fig. 4 with image from Zheng et al., 2018
Fig. 7 from Zheng et al., 2016
Fig. 8 from Aboualaiwi et al., 2014
Fig. 4 from Feng et al., 2008
ventral wall of dorsal aorta myb expression decreased amount, abnormal AB + MO3-pkd2 control Fig. 3 with image from Liu et al., 2019
heart decreased functionality, abnormal AB + MO3-pkd2 standard conditions Fig. S13 from Pala et al., 2019
ventral wall of dorsal aorta runx1 expression decreased amount, abnormal AB + MO3-pkd2 control Fig. 3 with imageFig. 5 with image from Liu et al., 2019
blood vessel decreased diameter, abnormal AB + MO3-pkd2 standard conditions Fig. S13 from Pala et al., 2019
whole organism curved dorsal, abnormal AB/TU + MO3-pkd2 chemical treatment by environment: valproic acid Fig. 2 with image from Cao et al., 2009
pronephros cystic, abnormal AB/TU + MO3-pkd2 chemical treatment by environment: valpromide Fig. 2 with image from Cao et al., 2009
pronephros structure, ameliorated AB/TU + MO3-pkd2 chemical treatment by environment: trichostatin A Fig. 1 with image from Cao et al., 2009
pronephros cystic, abnormal AB/TU + MO3-pkd2 control Fig. 1 with image from Cao et al., 2009
whole organism curved dorsal, abnormal AB/TU + MO3-pkd2 control Fig. 1 with image from Cao et al., 2009
pronephros structure, ameliorated AB/TU + MO3-pkd2 chemical treatment by environment: valproic acid Fig. 2 with image from Cao et al., 2009
whole organism curved dorsal, abnormal AB/TU + MO3-pkd2 chemical treatment by environment: trichostatin A Fig. 1 with image from Cao et al., 2009
pronephros cystic, ameliorated TL + MO3-pkd2 chemical treatment by environment: Brilliant Blue Fig. 7 from Verschuren et al., 2020
whole organism decreased life span, abnormal TL + MO3-pkd2 standard conditions Fig. 7 from Verschuren et al., 2020
pericardium edematous, abnormal TL + MO3-pkd2 chemical treatment by environment: Brilliant Blue Fig. 7 from Verschuren et al., 2020
post-vent region curvature, ameliorated TL + MO3-pkd2 chemical treatment by environment: Brilliant Blue Fig. 7 from Verschuren et al., 2020
whole organism life span, ameliorated TL + MO3-pkd2 chemical treatment by environment: Brilliant Blue Fig. 7 from Verschuren et al., 2020
pronephros cystic, abnormal TL + MO3-pkd2 standard conditions Fig. 7 from Verschuren et al., 2020
post-vent region curved, abnormal TL + MO3-pkd2 standard conditions Fig. 7 from Verschuren et al., 2020
pericardium edematous, abnormal TL + MO3-pkd2 standard conditions Fig. 7 from Verschuren et al., 2020
whole organism Ab3-yap1 labeling decreased amount, abnormal TU + MO3-pkd2 standard conditions Fig. 5 from Xu et al., 2018
pronephric duct Ab2-scrib labeling decreased amount, abnormal TU + MO3-pkd2 standard conditions Fig. 1 from Xu et al., 2018
whole organism Ab2-lats1 labeling decreased amount, abnormal TU + MO3-pkd2 standard conditions Fig. 5 from Xu et al., 2018
whole organism ccn2a expression increased amount, abnormal TU + MO3-pkd2 standard conditions Fig. 5 from Xu et al., 2018
pronephric duct cystic, abnormal TU + MO3-pkd2 standard conditions Fig. 2Fig. 5Fig. 7 from Xu et al., 2018
whole organism Ab2-scrib labeling decreased amount, abnormal TU + MO3-pkd2 standard conditions Fig. 1 from Xu et al., 2018
whole organism ccn1 expression increased amount, abnormal TU + MO3-pkd2 standard conditions Fig. 5 from Xu et al., 2018
whole organism Ab3-lats1 labeling decreased amount, abnormal TU + MO3-pkd2 standard conditions Fig. 5 from Xu et al., 2018
whole organism curved dorsal, abnormal WT + MO3-pkd2 standard conditions Fig. 4 from Sun et al., 2019
pronephros morphogenesis decreased process quality, abnormal WT + MO3-pkd2 standard conditions Fig. 3 with imageFig. 4 with image from Chang et al., 2017
cell proliferation involved in pronephros development increased occurrence, abnormal WT + MO3-pkd2 standard conditions Fig. 4 from Chang et al., 2011
post-vent region curved dorsal, abnormal WT + MO3-pkd2 standard conditions Fig. 6 with image from Arif Pavel et al., 2016
Fig. 9 with image from Rothschild et al., 2011
Fig. 1 from Yuan et al., 2009
pronephric duct anatomical region has extra parts of type leukocyte, abnormal WT + MO3-pkd2 standard conditions Fig. 4 with image from Chang et al., 2017
heart looping disrupted, abnormal WT + MO3-pkd2 standard conditions Fig. 8 from Giamarchi et al., 2010
pronephros anterior region truncated, abnormal WT + MO3-pkd2 standard conditions Fig. 9 with image from Rothschild et al., 2011
hypoblast calcium-mediated signaling process quality, abnormal WT + MO3-pkd2 standard conditions Fig. 4 with image from Yuan et al., 2015
brain hydrocephalic, abnormal WT + MO3-pkd2 standard conditions Fig. 6 from Sussman et al., 2014
Fig. 9 with image from Rothschild et al., 2011
Fig. 8 from Giamarchi et al., 2010
post-vent region curved, abnormal WT + MO3-pkd2 standard conditions Fig. 4 with image from Fogelgren et al., 2011
pronephric duct distal region obstructed, abnormal WT + MO3-pkd2 standard conditions Fig. 9 with image from Rothschild et al., 2011
whole organism cAMP-dependent protein kinase activity increased occurrence, abnormal WT + MO3-pkd2 chemical treatment by environment: metformin Fig. 5 with image from Chang et al., 2017
pronephros cystic, abnormal WT + MO3-pkd2 standard conditions FIGURE 4 with image from Chen et al., 2021
Fig. 4 from Sun et al., 2019
Fig. 6 from Sussman et al., 2014
Fig. 8 from Giamarchi et al., 2010
Fig. 1 with imageTable 2 from Sun et al., 2004
pronephric glomerulus increased size, abnormal WT + MO3-pkd2 standard conditions Fig. 8 with image from Sullivan-Brown et al., 2008
pronephric duct epithelial cell proliferation occurrence, ameliorated WT + MO3-pkd2 chemical treatment by environment: metformin Fig. 3 with image from Chang et al., 2017
trunk increased curvature, abnormal WT + MO3-pkd2 standard conditions Fig. 6 from Sussman et al., 2014
inner ear posterior-most region increased distance pronephric duct anterior-most region, abnormal WT + MO3-pkd2 standard conditions Fig. 9 with image from Rothschild et al., 2011
calcium/calmodulin-dependent protein kinase activity decreased occurrence, abnormal WT + MO3-pkd2 standard conditions Fig. 8 with image from Rothschild et al., 2011
Kupffer's vesicle calcium-mediated signaling process quality, abnormal WT + MO3-pkd2 standard conditions Fig. 2 with image from Yuan et al., 2015
cloacal chamber cilium decreased amount, abnormal WT + MO3-pkd2 standard conditions Fig. 9 with image from Rothschild et al., 2011
post-vent region increased curvature, abnormal WT + MO3-pkd2 standard conditions Fig. 6 with image from Arif Pavel et al., 2016
Fig. 1 with imageTable 2 from Sun et al., 2004
calcium/calmodulin-dependent protein kinase activity decreased rate, abnormal WT + MO3-pkd2 standard conditions Fig. 7 with image from Francescatto et al., 2010
whole organism dcn expression decreased amount, abnormal WT + MO3-pkd2 standard conditions Fig. 6 from Liu et al., 2019
gut edematous, abnormal WT + MO3-pkd2 standard conditions Fig. S1 from Chang et al., 2011
protein autophosphorylation decreased occurrence, abnormal WT + MO3-pkd2 standard conditions Fig. 7 with image from Francescatto et al., 2010
cloacal chamber cilium decreased length, abnormal WT + MO3-pkd2 standard conditions Fig. 9 with image from Rothschild et al., 2011
pronephric duct epithelial cell proliferation increased occurrence, abnormal WT + MO3-pkd2 standard conditions Fig. 3 with image from Chang et al., 2017
whole organism Ab1-prkaa labeling increased amount, abnormal WT + MO3-pkd2 chemical treatment by environment: metformin Fig. 5 with image from Chang et al., 2017
determination of left/right symmetry process quality, abnormal WT + MO3-pkd2 standard conditions text only from Fogelgren et al., 2011
determination of heart left/right asymmetry disrupted, abnormal WT + MO3-pkd2 standard conditions Fig. 8 from Giamarchi et al., 2010
pronephros cystic, ameliorated WT + MO3-pkd2 chemical treatment by environment: NS-398 FIGURE 4 with image from Chen et al., 2021
whole organism increased curvature, abnormal WT + MO3-pkd2 standard conditions Fig. 8 from Giamarchi et al., 2010
head hydrocephalic, abnormal WT + MO3-pkd2 standard conditions Fig. 4 from Sun et al., 2019
pronephros anterior region structure, abnormal WT + MO3-pkd2 standard conditions Fig. 9 with image from Rothschild et al., 2011
pronephric duct anatomical region has number of leukocyte, ameliorated WT + MO3-pkd2 chemical treatment by environment: metformin Fig. 4 with image from Chang et al., 2017
trunk curved dorsal, abnormal WT + MO3-pkd2 standard conditions Fig. 3 from Bouvrette et al., 2010
whole organism Ab2-prkaa labeling increased amount, abnormal WT + MO3-pkd2 chemical treatment by environment: metformin Fig. 5 with image from Chang et al., 2017
heart mislocalised, abnormal WT + MO3-pkd2 standard conditions Fig. 8 from Giamarchi et al., 2010
heart edematous, abnormal WT + MO3-pkd2 standard conditions Fig. 8 from Giamarchi et al., 2010
determination of heart left/right asymmetry decreased process quality, abnormal WT + MO3-pkd2 + MO9-pkd2 standard conditions Fig. 1 with image from Roxo-Rosa et al., 2015
Kupffer's vesicle motile cilium pkd2 expression absent, abnormal WT + MO3-pkd2 + MO9-pkd2 standard conditions Fig. 1 with image from Roxo-Rosa et al., 2015
Kupffer's vesicle development process quality, abnormal WT + MO3-pkd2 + MO9-pkd2 standard conditions Fig. 4 with image from Roxo-Rosa et al., 2015
post-vent region curved dorsal, abnormal WT + MO3-pkd2 + MO9-pkd2 standard conditions Fig. 1 with image from Roxo-Rosa et al., 2015
Kupffer's vesicle cytoplasm pkd2 expression decreased amount, abnormal WT + MO3-pkd2 + MO9-pkd2 standard conditions Fig. 1 with image from Roxo-Rosa et al., 2015
Kupffer's vesicle increased area, abnormal WT + MO3-pkd2 + MO9-pkd2 standard conditions Fig. 4 with image from Roxo-Rosa et al., 2015
heart mislocalised, abnormal WT + MO3-pkd2 + MO9-pkd2 standard conditions Fig. 1 with image from Roxo-Rosa et al., 2015
pronephric duct Ab6-map1lc3b labeling decreased amount, abnormal li1Tg + MO3-pkd2 standard conditions Fig. 7 with image from Chang et al., 2017
vent malformed, abnormal li1Tg + MO3-pkd2 standard conditions Fig. 2 with image from Chang et al., 2017
pronephric duct Ab6-map1lc3b labeling decreased distribution, abnormal li1Tg + MO3-pkd2 standard conditions Fig. 7 with image from Chang et al., 2017
pronephros cystic, ameliorated li1Tg + MO3-pkd2 chemical treatment by environment: metformin Fig. 1 with image from Chang et al., 2017
pronephric duct Ab6-map1lc3b labeling amount, ameliorated li1Tg + MO3-pkd2 chemical treatment by environment: metformin Fig. 7 with image from Chang et al., 2017
pronephric glomerulus EGFP expression increased distribution, abnormal li1Tg + MO3-pkd2 standard conditions Fig. 6 with image from Arif Pavel et al., 2016
pronephric duct autophagy occurrence, ameliorated li1Tg + MO3-pkd2 chemical treatment by environment: metformin Fig. 7 with image from Chang et al., 2017
vent morphology, ameliorated li1Tg + MO3-pkd2 chemical treatment by environment: metformin Fig. 2 with image from Chang et al., 2017
post-vent region curved dorsal, abnormal li1Tg + MO3-pkd2 standard conditions Fig. 2 with image from Chang et al., 2017
post-vent region curvature, ameliorated li1Tg + MO3-pkd2 chemical treatment by environment: metformin Fig. 2 with image from Chang et al., 2017
pronephric tubule dilated, abnormal li1Tg + MO3-pkd2 standard conditions Fig. 2 from Chang et al., 2011
pronephric duct Ab6-map1lc3b labeling spatial pattern, ameliorated li1Tg + MO3-pkd2 chemical treatment by environment: metformin Fig. 7 with image from Chang et al., 2017
pronephric duct cystic, abnormal li1Tg + MO3-pkd2 standard conditions Fig. 2 from Chang et al., 2011
pronephric glomerulus increased diameter, abnormal li1Tg + MO3-pkd2 standard conditions Fig. 8 with image from Arhatte et al., 2019
pronephric duct autophagy decreased occurrence, abnormal li1Tg + MO3-pkd2 standard conditions Fig. 7 with image from Chang et al., 2017
pronephros cystic, abnormal li1Tg + MO3-pkd2 standard conditions Fig. 1 with imageFig. 7 with image from Chang et al., 2017
pronephric glomerulus dilated, abnormal li1Tg + MO3-pkd2 standard conditions Fig. 6 with image from Arif Pavel et al., 2016
Fig. 2 from Chang et al., 2011
pronephric glomerulus cystic, abnormal li1Tg + MO3-pkd2 standard conditions Fig. 8 with image from Arhatte et al., 2019
Fig. 6 with image from Arif Pavel et al., 2016
pronephros morphogenesis decreased process quality, abnormal li1Tg + MO3-pkd2 standard conditions Fig. 1 with imageFig. 7 with image from Chang et al., 2017
heart looping process quality, abnormal twu34Tg + MO3-pkd2 standard conditions Fig. 7 from Hurd et al., 2010
calcium/calmodulin-dependent protein kinase activity decreased occurrence, abnormal zf34Tg + MO3-pkd2 standard conditions Fig. 8 with image from Rothschild et al., 2011
blood vessel cilium decreased length, abnormal hsc5Tg; pku6Tg + MO3-pkd2 control Fig. 2 with image from Liu et al., 2019
blood vessel cilium decreased amount, abnormal hsc5Tg; pku6Tg + MO3-pkd2 control Fig. 2 with image from Liu et al., 2019
ventral wall of dorsal aorta endothelial cell mCherry expression decreased amount, abnormal jh11Tg; y1Tg + MO3-pkd2 control Fig. 6 with image from Liu et al., 2019
pronephric duct cystic, exacerbated lats1zf2211/+ + MO3-pkd2 standard conditions Fig. 7 from Xu et al., 2018
pronephric duct cystic, exacerbated lats1zf2211/zf2211 + MO3-pkd2 standard conditions Fig. 7 from Xu et al., 2018
pronephric duct cystic, exacerbated scribzf2209/+ + MO3-pkd2 standard conditions Fig. 7 from Xu et al., 2018
pronephric duct cystic, exacerbated scribzf2209/zf2209 + MO3-pkd2 standard conditions Fig. 7 from Xu et al., 2018
post-vent region curvature, ameliorated AB + MO1-fubp1 + MO3-pkd2 standard conditions Fig. 6 from Zheng et al., 2016
pronephric duct cystic, exacerbated TU + MO2-yap1 + MO3-pkd2 standard conditions Fig. 7 from Xu et al., 2018
cloacal chamber cilium decreased amount, abnormal WT + MO1-camk2g1 + MO3-pkd2 standard conditions Fig. 10 with image from Rothschild et al., 2011
cell migration involved in kidney development disrupted, abnormal WT + MO1-camk2g1 + MO3-pkd2 standard conditions Fig. 10 with image from Rothschild et al., 2011
pronephric duct distal region obstructed, abnormal WT + MO1-camk2g1 + MO3-pkd2 standard conditions Fig. 10 with image from Rothschild et al., 2011
pronephros anterior region structure, abnormal WT + MO1-camk2g1 + MO3-pkd2 standard conditions Fig. 10 with image from Rothschild et al., 2011
inner ear posterior-most region increased distance pronephric duct anterior-most region, abnormal WT + MO1-camk2g1 + MO3-pkd2 standard conditions Fig. 10 with image from Rothschild et al., 2011
pronephros anterior region truncated, abnormal WT + MO1-camk2g1 + MO3-pkd2 standard conditions Fig. 10 with image from Rothschild et al., 2011
cloacal chamber cilium decreased length, abnormal WT + MO1-camk2g1 + MO3-pkd2 standard conditions Fig. 10 with image from Rothschild et al., 2011
post-vent region curved, abnormal WT + MO1-exoc5 + MO3-pkd2 standard conditions Fig. 4 with image from Fogelgren et al., 2011
whole organism curved dorsal, exacerbated WT + MO1-hexim1 + MO3-pkd2 standard conditions Fig. 4 from Sun et al., 2019
whole organism hexim1 expression absent, abnormal WT + MO1-hexim1 + MO3-pkd2 standard conditions Fig. 4 from Sun et al., 2019
head hydrocephalic, abnormal WT + MO1-hexim1 + MO3-pkd2 standard conditions Fig. 4 from Sun et al., 2019
pronephros cystic, exacerbated WT + MO1-hexim1 + MO3-pkd2 standard conditions Fig. 4 from Sun et al., 2019
pronephros morphogenesis decreased process quality, abnormal li1Tg + MO3-pkd2 + MO4-atg5 standard conditions Fig. 7 with image from Chang et al., 2017
pronephros cystic, exacerbated li1Tg + MO3-pkd2 + MO4-atg5 standard conditions Fig. 7 with image from Chang et al., 2017
heart looping process quality, abnormal twu34Tg + MO2-rp2 + MO3-pkd2 standard conditions Fig. 7 from Hurd et al., 2010
post-vent region curled, abnormal vu119Tg + MO3-pkd2 standard conditions Fig. 3 from Padhy et al., 2022
pronephric tubule cystic, abnormal vu119Tg + MO3-pkd2 standard conditions Fig. 3 from Padhy et al., 2022
trunk curved dorsal, abnormal vu119Tg + MO3-pkd2 standard conditions Fig. 3 from Padhy et al., 2022
Kupffer's vesicle development process quality, abnormal vu119Tg + MO3-pkd2 + MO9-pkd2 control Fig. 2 with image from Roxo-Rosa et al., 2015
Kupffer's vesicle development process quality, abnormal vu119Tg + MO3-pkd2 + MO9-pkd2 chemical treatment: CFTRinh-172 Fig. 2 with image from Roxo-Rosa et al., 2015
Kupffer's vesicle epithelial cell 3-D shape, abnormal vu119Tg + MO3-pkd2 + MO9-pkd2 chemical treatment: forskolin, chemical treatment: 3-isobutyl-1-methyl-7H-xanthine Fig. 3 with image from Roxo-Rosa et al., 2015
Kupffer's vesicle increased volume, abnormal vu119Tg + MO3-pkd2 + MO9-pkd2 chemical treatment: forskolin, chemical treatment: 3-isobutyl-1-methyl-7H-xanthine Fig. 2 with image from Roxo-Rosa et al., 2015
Kupffer's vesicle increased volume, abnormal vu119Tg + MO3-pkd2 + MO9-pkd2 control Fig. 2 with image from Roxo-Rosa et al., 2015
Kupffer's vesicle volume, ameliorated vu119Tg + MO3-pkd2 + MO9-pkd2 chemical treatment: ouabain Fig. S2 with image from Roxo-Rosa et al., 2015
Kupffer's vesicle development process quality, abnormal vu119Tg + MO3-pkd2 + MO9-pkd2 chemical treatment: forskolin, chemical treatment: 3-isobutyl-1-methyl-7H-xanthine Fig. 2 with imageFig. 3 with image from Roxo-Rosa et al., 2015
Kupffer's vesicle decreased volume, abnormal vu119Tg + MO3-pkd2 + MO9-pkd2 chemical treatment: CFTRinh-172 Fig. 2 with image from Roxo-Rosa et al., 2015
Kupffer's vesicle apical part of cell increased area, abnormal vu119Tg + MO3-pkd2 + MO9-pkd2 chemical treatment: forskolin, chemical treatment: 3-isobutyl-1-methyl-7H-xanthine Fig. 3 with image from Roxo-Rosa et al., 2015
pronephric duct cytoplasm EGFP expression decreased amount, abnormal zf2206Tg + MO3-pkd2 standard conditions Fig. 5 from Xu et al., 2018
pronephric duct nucleus EGFP expression increased amount, abnormal zf2206Tg + MO3-pkd2 standard conditions Fig. 5 from Xu et al., 2018
Kupffer's vesicle development process quality, abnormal vu119Tg + MO3-pkd2 + MO4-cftr + MO9-pkd2 control Fig. 2 with image from Roxo-Rosa et al., 2015
Kupffer's vesicle decreased volume, abnormal vu119Tg + MO3-pkd2 + MO4-cftr + MO9-pkd2 control Fig. 2 with image from Roxo-Rosa et al., 2015
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell decreased amount, abnormal pku6Tg; zf169Tg + MO3-pkd2 control Fig. 5 with image from Liu et al., 2019
pronephric glomerulus cystic, abnormal tmem33sh443/+; li1Tg + MO3-pkd2 standard conditions Fig. 8 with image from Arhatte et al., 2019
pronephric glomerulus increased diameter, abnormal tmem33sh443/+; li1Tg + MO3-pkd2 standard conditions Fig. 8 with image from Arhatte et al., 2019
pronephric glomerulus cystic, abnormal tmem33sh443/sh443; li1Tg + MO3-pkd2 standard conditions Fig. 8 with image from Arhatte et al., 2019
pronephric glomerulus increased diameter, abnormal tmem33sh443/sh443; li1Tg + MO3-pkd2 standard conditions Fig. 8 with image from Arhatte et al., 2019
Citations