Morpholino

MO1-cdh4

ID

ZDB-MRPHLNO-050930-2

Name

MO1-cdh4

Previous Names

RcadMphA (1)

Target

cdh4 (1)

Sequence

5' - AAGGAGGCAGATGTTTGTTATTCAC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-cdh4

Expressed Gene	Anatomy	Figures
alcama	retinal ganglion cell layer	Fig. 5 from Babb et al., 2005
cdh2	neuromast posterior lateral line primordium	Fig. 8 from Wilson et al., 2007
cdh4	(not) amacrine cell (not) cranial nerve II hindbrain posterior lateral line ganglion (not) retinal ganglion cell layer vagal ganglion 1 vagal ganglion 2 vagal ganglion 3 vagal ganglion 4 (not) whole organism	Fig. 1 from Wilson et al., 2007 Fig. 3 from Babb et al., 2005
cdh6	middle lateral line ganglion posterior lateral line ganglion vagal ganglion 1 vagal ganglion 2 vagal ganglion 3 vagal ganglion 4	Fig. 3 from Wilson et al., 2007
crx	epiphysis retinal inner nuclear layer retinal photoreceptor layer	Fig. 9 from Liu et al., 2007 Fig. 6 from Babb et al., 2005
cxcr4b	posterior lateral line primordium	Fig. 8 from Wilson et al., 2007
elavl3	dorsal anterior lateral line ganglion middle lateral line ganglion posterior lateral line ganglion statoacoustic (VIII) ganglion trigeminal ganglion vagal ganglion 1 vagal ganglion 2 vagal ganglion 3 vagal ganglion 4	Fig. 2 from Wilson et al., 2007
gnat1	epiphysis retina	Fig. 6, text only from Liu et al., 2007
gnat2	epiphysis retina	Fig. 6, text only from Liu et al., 2007
neurod1	posterior lateral line ganglion vagal ganglion 1 vagal ganglion 2 vagal ganglion 3 vagal ganglion 4	Fig. 3 from Wilson et al., 2007
opn1sw1	retina	Fig. 6 from Liu et al., 2007
otx5	epiphysis retinal inner nuclear layer retinal photoreceptor layer	Fig. 9 from Liu et al., 2007 Fig. 6 from Babb et al., 2005
rbp3	epiphysis (not) eye photoreceptor cell retinal pigmented epithelium	Fig. 6, text only from Liu et al., 2007
rho	retinal rod cell	text only from Liu et al., 2007

Phenotype

Phenotype resulting from MO1-cdh4

Phenotype	Fish	Figures
amacrine cell differentiation disrupted, abnormal	WT + MO1-cdh4	Fig. 5 from Babb et al., 2005
apoptotic process increased occurrence, abnormal	WT + MO1-cdh4	Fig. 10 from Liu et al., 2007 Fig. 7 from Babb et al., 2005
brain disorganized, abnormal	WT + MO1-cdh4	Fig. 1 from Babb et al., 2005
cell death increased occurrence, abnormal	WT + MO1-cdh4	Fig. 5 from Wilson et al., 2007
cranial nerve decreased size, abnormal	WT + MO1-cdh4	Fig. 4 from Wilson et al., 2007
cranial nerve II decreased thickness, abnormal	WT + MO1-cdh4	Fig. 5 from Babb et al., 2005
cranial nerve II fasciculation, abnormal	WT + MO1-cdh4	Fig. 4 from Babb et al., 2005
cranial nerve II sparse, abnormal	WT + MO1-cdh4	Fig. 4 , Fig. 9 from Babb et al., 2005
cranial nerve II truncated, abnormal	WT + MO1-cdh4	Fig. 9 from Babb et al., 2005
eye decreased size, abnormal	WT + MO1-cdh4	text only from Liu et al., 2007 text only from Wilson et al., 2007 Fig. 1 , Fig. 2 , Fig. 3 , Fig. 4 from Babb et al., 2005
fourth ventricle increased size, abnormal	WT + MO1-cdh4	Fig. 1 from Babb et al., 2005
hindbrain decreased size, abnormal	WT + MO1-cdh4	Fig. 1 from Babb et al., 2005
lateral line nerve decreased size, abnormal	WT + MO1-cdh4	Fig. 4 from Wilson et al., 2007
lens apoptotic, abnormal	WT + MO1-cdh4	Fig. 7 from Babb et al., 2005
lens decreased size, abnormal	WT + MO1-cdh4	Fig. 1 , Fig. 2 , Fig. 3 , Fig. 4 from Babb et al., 2005
lens opaque, abnormal	AB + MO1-cdh4	text only from Liu et al., 2007
neuromast decreased amount, abnormal	WT + MO1-cdh4	Fig. 7 , text only from Wilson et al., 2007
optic nerve development disrupted, abnormal	WT + MO1-cdh4	Fig. 4 from Babb et al., 2005
optic tectum morphology, abnormal	WT + MO1-cdh4	Fig. 8 , Fig. 9 from Babb et al., 2005
photoreceptor cell differentiation disrupted, abnormal	WT + MO1-cdh4	Fig. 5 , Fig. 6 from Babb et al., 2005
posterior lateral line nerve decreased length, abnormal	WT + MO1-cdh4	Fig. 6 from Wilson et al., 2007
posterior lateral line neuromast primordium migration decreased rate, abnormal	WT + MO1-cdh4	Fig. 8 from Wilson et al., 2007
retina apoptotic, abnormal	WT + MO1-cdh4	Fig. 7 from Babb et al., 2005
retina hypoplastic, abnormal	WT + MO1-cdh4	Fig. 2 from Babb et al., 2005
retina lacks parts or has fewer parts of type amacrine cell, abnormal	WT + MO1-cdh4	Fig. 5 from Babb et al., 2005
retina lacks parts or has fewer parts of type photoreceptor cell, abnormal	WT + MO1-cdh4	Fig. 5 from Babb et al., 2005
retina structure, abnormal	AB + MO1-cdh4	text only from Liu et al., 2007
retina development in camera-type eye disrupted, abnormal	WT + MO1-cdh4	Fig. 5 from Babb et al., 2005
retina layer formation disrupted, abnormal	WT + MO1-cdh4	Fig. 1 , Fig. 2 , Fig. 6 from Babb et al., 2005
retina morphogenesis in camera-type eye disrupted, abnormal	AB + MO1-cdh4	text only from Liu et al., 2007
retinal ganglion cell decreased amount, abnormal	WT + MO1-cdh4	Fig. 5 from Babb et al., 2005
retinal ganglion cell lacks parts or has fewer parts of type retinal ganglion cell neuron projection, abnormal	WT + MO1-cdh4	Fig. 4 from Babb et al., 2005
retinal ganglion cell neuron projection physical object quality, abnormal	WT + MO1-cdh4	Fig. 8 , Fig. 9 from Babb et al., 2005
retinal ganglion cell axon guidance disrupted, abnormal	WT + MO1-cdh4	Fig. 4 , Fig. 9 from Babb et al., 2005
retinal ganglion cell layer decreased thickness, abnormal	WT + MO1-cdh4	Fig. 5 from Babb et al., 2005
retinal ganglion cell layer disorganized, abnormal	WT + MO1-cdh4	Fig. 4 from Babb et al., 2005
retinal ganglion cell layer sparse, abnormal	WT + MO1-cdh4	Fig. 4 , Fig. 5 from Babb et al., 2005
retinal ganglion cell layer compartment boundary rough, abnormal	WT + MO1-cdh4	Fig. 5 from Babb et al., 2005
whole organism decreased length, abnormal	WT + MO1-cdh4	Fig. 1 from Babb et al., 2005

Phenotype of all Fish created by or utilizing MO1-cdh4

Phenotype	Fish	Conditions	Figures
retina morphogenesis in camera-type eye disrupted, abnormal	AB + MO1-cdh4	standard conditions	text only from Liu et al., 2007
lens opaque, abnormal	AB + MO1-cdh4	standard conditions	text only from Liu et al., 2007
apoptotic process increased occurrence, abnormal	AB + MO1-cdh4	standard conditions	Fig. 10 from Liu et al., 2007
eye decreased size, abnormal	AB + MO1-cdh4	standard conditions	text only from Liu et al., 2007
retina structure, abnormal	AB + MO1-cdh4	standard conditions	text only from Liu et al., 2007
retinal ganglion cell decreased amount, abnormal	WT + MO1-cdh4	standard conditions	Fig. 5 from Babb et al., 2005
lateral line nerve decreased size, abnormal	WT + MO1-cdh4	standard conditions	Fig. 4 from Wilson et al., 2007
retina apoptotic, abnormal	WT + MO1-cdh4	standard conditions	Fig. 7 from Babb et al., 2005
photoreceptor cell differentiation disrupted, abnormal	WT + MO1-cdh4	standard conditions	Fig. 5 , Fig. 6 from Babb et al., 2005
eye decreased size, abnormal	WT + MO1-cdh4	standard conditions	text only from Wilson et al., 2007 Fig. 1 , Fig. 2 , Fig. 3 , Fig. 4 from Babb et al., 2005
lens decreased size, abnormal	WT + MO1-cdh4	standard conditions	Fig. 1 , Fig. 2 , Fig. 3 , Fig. 4 from Babb et al., 2005
posterior lateral line neuromast primordium migration decreased rate, abnormal	WT + MO1-cdh4	standard conditions	Fig. 8 from Wilson et al., 2007
retinal ganglion cell lacks parts or has fewer parts of type retinal ganglion cell neuron projection, abnormal	WT + MO1-cdh4	standard conditions	Fig. 4 from Babb et al., 2005
amacrine cell differentiation disrupted, abnormal	WT + MO1-cdh4	standard conditions	Fig. 5 from Babb et al., 2005
apoptotic process increased occurrence, abnormal	WT + MO1-cdh4	standard conditions	Fig. 7 from Babb et al., 2005
retinal ganglion cell layer sparse, abnormal	WT + MO1-cdh4	standard conditions	Fig. 4 , Fig. 5 from Babb et al., 2005
retinal ganglion cell layer compartment boundary rough, abnormal	WT + MO1-cdh4	standard conditions	Fig. 5 from Babb et al., 2005
posterior lateral line nerve decreased length, abnormal	WT + MO1-cdh4	standard conditions	Fig. 6 from Wilson et al., 2007
retina lacks parts or has fewer parts of type photoreceptor cell, abnormal	WT + MO1-cdh4	standard conditions	Fig. 5 from Babb et al., 2005
retina hypoplastic, abnormal	WT + MO1-cdh4	standard conditions	Fig. 2 from Babb et al., 2005
hindbrain decreased size, abnormal	WT + MO1-cdh4	standard conditions	Fig. 1 from Babb et al., 2005
neuromast decreased amount, abnormal	WT + MO1-cdh4	standard conditions	Fig. 7 , text only from Wilson et al., 2007
cranial nerve decreased size, abnormal	WT + MO1-cdh4	standard conditions	Fig. 4 from Wilson et al., 2007
cranial nerve II decreased thickness, abnormal	WT + MO1-cdh4	standard conditions	Fig. 5 from Babb et al., 2005
fourth ventricle increased size, abnormal	WT + MO1-cdh4	standard conditions	Fig. 1 from Babb et al., 2005
whole organism decreased length, abnormal	WT + MO1-cdh4	standard conditions	Fig. 1 from Babb et al., 2005
cranial nerve II truncated, abnormal	WT + MO1-cdh4	standard conditions	Fig. 9 from Babb et al., 2005
retina development in camera-type eye disrupted, abnormal	WT + MO1-cdh4	standard conditions	Fig. 5 from Babb et al., 2005
retina layer formation disrupted, abnormal	WT + MO1-cdh4	standard conditions	Fig. 1 , Fig. 2 , Fig. 6 from Babb et al., 2005
retinal ganglion cell layer disorganized, abnormal	WT + MO1-cdh4	standard conditions	Fig. 4 from Babb et al., 2005
retinal ganglion cell axon guidance disrupted, abnormal	WT + MO1-cdh4	standard conditions	Fig. 4 , Fig. 9 from Babb et al., 2005
cell death increased occurrence, abnormal	WT + MO1-cdh4	standard conditions	Fig. 5 from Wilson et al., 2007
retina lacks parts or has fewer parts of type amacrine cell, abnormal	WT + MO1-cdh4	standard conditions	Fig. 5 from Babb et al., 2005
retinal ganglion cell layer decreased thickness, abnormal	WT + MO1-cdh4	standard conditions	Fig. 5 from Babb et al., 2005
cranial nerve II sparse, abnormal	WT + MO1-cdh4	standard conditions	Fig. 4 , Fig. 9 from Babb et al., 2005
brain disorganized, abnormal	WT + MO1-cdh4	standard conditions	Fig. 1 from Babb et al., 2005
retinal ganglion cell neuron projection physical object quality, abnormal	WT + MO1-cdh4	standard conditions	Fig. 8 , Fig. 9 from Babb et al., 2005
cranial nerve II fasciculation, abnormal	WT + MO1-cdh4	standard conditions	Fig. 4 from Babb et al., 2005
optic tectum morphology, abnormal	WT + MO1-cdh4	standard conditions	Fig. 8 , Fig. 9 from Babb et al., 2005
optic nerve development disrupted, abnormal	WT + MO1-cdh4	standard conditions	Fig. 4 from Babb et al., 2005
lens apoptotic, abnormal	WT + MO1-cdh4	standard conditions	Fig. 7 from Babb et al., 2005
apoptotic process increased occurrence, abnormal	cdh2^m117/m117 + MO1-cdh4 (AB)	standard conditions	Fig. 10 from Liu et al., 2007
eye shape, abnormal	cdh2^m117/m117 + MO1-cdh4 (AB)	standard conditions	Fig. 8 from Liu et al., 2007

Citations