header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-050413-1
Morpholino Name: MO1-dnd1
Target: dnd1 (1)
Previous Names: MO-dnd-1, αPGC-MO (1), alpha PGC-MO (1), dead end MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GCTGGGCATCCATGTCTCCGACCAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-dnd1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-dnd1
Expressed Gene Anatomy Figures
aldh1a2 Fig. 6 with image from Rodríguez-Marí et al., 2013
amh Fig. 6 from Webster et al., 2017
Fig. 4 with image from Rodriguez-Mari et al., 2010
Fig. 2 with image from Siegfried et al., 2008
ar text only from Gorelick et al., 2008
cyp11c1 Fig. 2 with image from Siegfried et al., 2008
cyp19a1a Fig. 4 with image from Rodriguez-Mari et al., 2010
Fig. 2 with imageFig. 4 with image from Siegfried et al., 2008
cyp26a1 Fig. 6 with image from Rodríguez-Marí et al., 2013
ddx4 Fig. 1 with imageFig. 6 with image from Gross-Thebing et al., 2017
Fig. 6 with image from Rodríguez-Marí et al., 2013
Fig. 4 with image from Rodriguez-Mari et al., 2010
Fig. 2 with image from Siegfried et al., 2008
Fig. 3 with image from Kedde et al., 2007
dmrt1 Fig. 1 with image from Webster et al., 2017
dnd1 Fig. 6 from Webster et al., 2017
egr2b Fig. 2 with image from Hernandez et al., 2007
en2b Fig. S4 with image from Hernandez et al., 2007
hoxb1a Fig. S4 with image from Hernandez et al., 2007
hoxd4a Fig. 2 with image from Hernandez et al., 2007
myod1 Fig. 6 with image from Gross-Thebing et al., 2017
nanos3 Fig. 3 with image from Kedde et al., 2007
odc1 Fig. 3 with image from Kedde et al., 2007
pax2a Fig. 2 with image from Hernandez et al., 2007
piwil1 Fig. 1 with image from Webster et al., 2017
Fig. 2 with image from Siegfried et al., 2008
sox9a Fig. 2 with imageFig. 4 with image from Siegfried et al., 2008
PHENOTYPE
Phenotype resulting from MO1-dnd1
Phenotype Figures
female gonad development aplastic growth, abnormal Fig. 3 with image from Siegfried et al., 2008
female gonad development arrested, abnormal Fig. 3 with image from Siegfried et al., 2008
female organism absent, abnormal Fig. 1 with image from Siegfried et al., 2008
female sex differentiation absent, abnormal Fig. 3 with image from Wong et al., 2015
germ cell migration disrupted, abnormal Fig. 2 with image from Wong et al., 2015
germ line cell absent, abnormal Fig. 1 with image from Webster et al., 2017
Fig. 1 with image from Siegfried et al., 2008
germ line cell DsRed expression mislocalised, abnormal Fig. 2 with image from Wong et al., 2015
gonad piwil1 expression absent, abnormal Fig. 1 with image from Webster et al., 2017
gonad primordium lacks all parts of type germ line cell, abnormal Fig. 2 with image from Wong et al., 2015
heart contraction disrupted, abnormal text only from Friedrichs et al., 2009
intestine neoplastic, abnormal Fig. 8 with image from Rodriguez-Mari et al., 2011
male gonad development delayed, abnormal Fig. 3 with image from Siegfried et al., 2008
male gonad development postdisplaced growth, abnormal Fig. 3 with image from Siegfried et al., 2008
male sex differentiation increased occurrence, abnormal Fig. 3 with image from Wong et al., 2015
ovarian follicle stage I aplastic, abnormal Fig. 3 with image from Siegfried et al., 2008
ovary aplastic, abnormal Fig. 1 with image from Siegfried et al., 2008
primordial germ cell ddx4 expression absent, abnormal Fig. 1 with image from Gross-Thebing et al., 2017
primordial germ cell decreased amount, abnormal Fig. 2 with image from Slanchev et al., 2009
primordial germ cell decreased cellular motility, abnormal Fig. 1 with imageFig. 4 with image from Goudarzi et al., 2012
primordial germ cell lacks all parts of type primordial germ cell bleb, abnormal Fig. 1 with imageFig. 4 with image from Goudarzi et al., 2012
primordial germ cell mislocalised, abnormal Fig. 1 with imageFig. 2 with image from Gross-Thebing et al., 2017
Fig. 2 with image from Wong et al., 2015
primordial germ cell morphology, abnormal Fig. 2 with image from Gross-Thebing et al., 2017
primordial germ cell shape, abnormal Fig. 1 with image from Goudarzi et al., 2012
primordial germ cell cell motility decreased occurrence, abnormal Fig. 1 with imageFig. 4 with image from Goudarzi et al., 2012
sperm absent, abnormal Fig. 3 with image from Wong et al., 2015
testis aplastic/hypoplastic, abnormal Fig. 3 with image from Wong et al., 2015
testis neoplastic, abnormal Fig. 8 with image from Rodriguez-Mari et al., 2011
whole organism sterile, abnormal Fig. 3 with image from Wong et al., 2015

Phenotype of all Fish created by or utilizing MO1-dnd1
Phenotype Fish Conditions Figures
primordial germ cell decreased amount, abnormal AB + MO1-dnd1 standard conditions Fig. 2 with image from Slanchev et al., 2009
primordial germ cell ddx4 expression absent, abnormal AB + MO1-dnd1 standard conditions Fig. 1 with image from Gross-Thebing et al., 2017
primordial germ cell shape, abnormal WT + MO1-dnd1 standard conditions Fig. 1 with image from Goudarzi et al., 2012
primordial germ cell lacks all parts of type primordial germ cell bleb, abnormal WT + MO1-dnd1 standard conditions Fig. 1 with imageFig. 4 with image from Goudarzi et al., 2012
primordial germ cell cell motility decreased occurrence, abnormal WT + MO1-dnd1 standard conditions Fig. 1 with imageFig. 4 with image from Goudarzi et al., 2012
primordial germ cell decreased cellular motility, abnormal WT + MO1-dnd1 standard conditions Fig. 1 with imageFig. 4 with image from Goudarzi et al., 2012
male gonad development delayed, abnormal WT + MO1-dnd1 standard conditions Fig. 3 with image from Siegfried et al., 2008
ovary aplastic, abnormal WT + MO1-dnd1 standard conditions Fig. 1 with image from Siegfried et al., 2008
ovarian follicle stage I aplastic, abnormal WT + MO1-dnd1 standard conditions Fig. 3 with image from Siegfried et al., 2008
testis neoplastic, abnormal WT + MO1-dnd1 standard conditions Fig. 8 with image from Rodriguez-Mari et al., 2011
female gonad development aplastic growth, abnormal WT + MO1-dnd1 standard conditions Fig. 3 with image from Siegfried et al., 2008
female gonad development arrested, abnormal WT + MO1-dnd1 standard conditions Fig. 3 with image from Siegfried et al., 2008
male gonad development postdisplaced growth, abnormal WT + MO1-dnd1 standard conditions Fig. 3 with image from Siegfried et al., 2008
female organism absent, abnormal WT + MO1-dnd1 standard conditions Fig. 1 with image from Siegfried et al., 2008
gonad piwil1 expression absent, abnormal WT + MO1-dnd1 standard conditions Fig. 1 with image from Webster et al., 2017
germ line cell absent, abnormal WT + MO1-dnd1 standard conditions Fig. 1 with image from Webster et al., 2017
Fig. 1 with image from Siegfried et al., 2008
heart contraction disrupted, abnormal WT + MO1-dnd1 standard conditions text only from Friedrichs et al., 2009
intestine neoplastic, abnormal WT + MO1-dnd1 standard conditions Fig. 8 with image from Rodriguez-Mari et al., 2011
primordial germ cell cell motility decreased occurrence, abnormal WT + MO1-dnd1 + MO4-tp53 standard conditions Fig. 4 with image from Goudarzi et al., 2012
primordial germ cell mislocalised, abnormal mu7Tg + MO1-dnd1 standard conditions Fig. 1 with imageFig. 2 with image from Gross-Thebing et al., 2017
primordial germ cell morphology, abnormal mu7Tg + MO1-dnd1 standard conditions Fig. 2 with image from Gross-Thebing et al., 2017
primordial germ cell mislocalised, abnormal pu5Tg + MO1-dnd1 standard conditions Fig. 2 with image from Wong et al., 2015
male sex differentiation increased occurrence, abnormal pu5Tg + MO1-dnd1 standard conditions Fig. 3 with image from Wong et al., 2015
female sex differentiation absent, abnormal pu5Tg + MO1-dnd1 standard conditions Fig. 3 with image from Wong et al., 2015
sperm absent, abnormal pu5Tg + MO1-dnd1 standard conditions Fig. 3 with image from Wong et al., 2015
germ cell migration disrupted, abnormal pu5Tg + MO1-dnd1 standard conditions Fig. 2 with image from Wong et al., 2015
germ line cell DsRed expression mislocalised, abnormal pu5Tg + MO1-dnd1 standard conditions Fig. 2 with image from Wong et al., 2015
testis aplastic/hypoplastic, abnormal pu5Tg + MO1-dnd1 standard conditions Fig. 3 with image from Wong et al., 2015
whole organism sterile, abnormal pu5Tg + MO1-dnd1 standard conditions Fig. 3 with image from Wong et al., 2015
gonad primordium lacks all parts of type germ line cell, abnormal pu5Tg + MO1-dnd1 standard conditions Fig. 2 with image from Wong et al., 2015
primordial germ cell myod1 expression increased amount, abnormal cxcl12at30516/t30516 + MO1-dnd1 standard conditions Fig. 6 with image from Gross-Thebing et al., 2017
primordial germ cell ddx4 expression decreased amount, abnormal cxcl12at30516/t30516 + MO1-dnd1 standard conditions Fig. 6 with image from Gross-Thebing et al., 2017
rhombomere 4 increased size, abnormal cyp26a1rw716/rw716 + MO1-dnd1 standard conditions Fig. 2 with imageFig. S4 with image from Hernandez et al., 2007
testis dnd1 expression absent, abnormal dmrt1zm00173004Tg/+ + MO1-dnd1 standard conditions Fig. 6 from Webster et al., 2017
male organism increased amount, abnormal dmrt1zm00173004Tg/zm00173004Tg + MO1-dnd1 standard conditions Fig. 3 from Webster et al., 2017
female organism absent, abnormal dmrt1zm00173004Tg/zm00173004Tg + MO1-dnd1 standard conditions Fig. 3 from Webster et al., 2017
testis dnd1 expression absent, abnormal dmrt1zm00173004Tg/zm00173004Tg + MO1-dnd1 standard conditions Fig. 6 from Webster et al., 2017
testis amh expression absent, abnormal dmrt1zm00173004Tg/zm00173004Tg + MO1-dnd1 standard conditions Fig. 6 from Webster et al., 2017
rhombomere 4 increased size, abnormal cyp26a1rw716/rw716 + MO1-cyp26b1 + MO1-dnd1 standard conditions Fig. 2 with imageFig. S4 with image from Hernandez et al., 2007
hindbrain morphology, abnormal cyp26a1rw716/rw716 + MO1-cyp26c1 + MO1-dnd1 standard conditions Fig. 2 with image from Hernandez et al., 2007
rhombomere 4 increased size, abnormal cyp26a1rw716/rw716 + MO1-cyp26c1 + MO1-dnd1 standard conditions Fig. S4 with image from Hernandez et al., 2007
hindbrain wholly posterioralized, abnormal cyp26a1rw716/rw716 + MO1-cyp26c1 + MO1-dnd1 standard conditions Fig. S4 with image from Hernandez et al., 2007
primordial germ cell cell motility decreased speed, abnormal WT + MO1-anxa5b + MO1-dnd1 + MO1-zeb1b + MO3-mylka + MO4-mylka + MO4-tp53 + MO5-mylka standard conditions Fig. 4 with image from Goudarzi et al., 2012
primordial germ cell ddx4 expression absent, abnormal mu7Tg + MO1-dnd1 + MO4-cxcl12a standard conditions Fig. 3 with image from Gross-Thebing et al., 2017
primordial germ cell myod1 expression increased amount, abnormal mu7Tg + MO1-dnd1 + MO4-cxcl12a standard conditions Fig. 3 with image from Gross-Thebing et al., 2017
primordial germ cell TFP expression increased amount, abnormal ka14Tg ; mu6Tg + MO1-dnd1 + MO4-cxcl12a standard conditions Fig. 3 with imageFig. 6 with image from Gross-Thebing et al., 2017
primordial germ cell mislocalised, abnormal ka14Tg ; mu6Tg + MO1-dnd1 + MO4-cxcl12a standard conditions Fig. 6 with image from Gross-Thebing et al., 2017
primordial germ cell morphology, abnormal ka14Tg ; mu6Tg + MO1-dnd1 + MO4-cxcl12a standard conditions Fig. 6 with image from Gross-Thebing et al., 2017
primordial germ cell transformed to somatic cell, abnormal ka14Tg ; mu6Tg + MO1-dnd1 + MO4-cxcl12a standard conditions Fig. 6 with image from Gross-Thebing et al., 2017
OTHER MO1-dnd1 MORPHOLINO PAGESNo links to external sites
CITATIONS (38)