Morpholino

MO1-dnd1

ID
ZDB-MRPHLNO-050413-1
Name
MO1-dnd1
Previous Names
  • MO-dnd-1
  • αPGC-MO (1)
  • alpha PGC-MO (1)
  • dead end MO (1)
Target
Sequence
5' - GCTGGGCATCCATGTCTCCGACCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-dnd1
Expressed Gene Anatomy Figures
ahr1a Fig. 3 from Pradhan et al., 2018
aldh1a2 Fig. 6 with image from Rodríguez-Marí et al., 2013
amh Fig. 6 from Webster et al., 2017
Fig. 4 with image from Rodriguez-Mari et al., 2010
Fig. 2 with image from Siegfried et al., 2008
apoeb Fig. 4 from Pradhan et al., 2018
ar Fig. 3 from Pradhan et al., 2018
text only from Gorelick et al., 2008
casp3a Fig. 4 from Pradhan et al., 2018
casp8 Fig. 4 from Pradhan et al., 2018
ctnnb1 Fig. 4 from Pradhan et al., 2018
cyp1a Fig. 3 from Pradhan et al., 2018
cyp11c1 Fig. 2 with image from Siegfried et al., 2008
cyp19a1a Fig. 4 with image from Rodriguez-Mari et al., 2010
Fig. 2 with image,  Fig. 4 with image from Siegfried et al., 2008
cyp19a1b Fig. 4 from Pradhan et al., 2018
cyp26a1 Fig. 6 with image from Rodríguez-Marí et al., 2013
ddx4 Fig. 1 from Pradhan et al., 2018
Fig. 1 with image,  Fig. 6 with image from Gross-Thebing et al., 2017
Fig. 6 with image from Rodríguez-Marí et al., 2013
Fig. 4 with image from Rodriguez-Mari et al., 2010
Fig. 2 with image from Siegfried et al., 2008
Fig. 3 with image from Kedde et al., 2007
dio2 Fig. 4 from Pradhan et al., 2018
dmrt1 Fig. 1 with image from Webster et al., 2017
dnd1 Fig. 1 from Pradhan et al., 2018
Fig. 6 from Webster et al., 2017
egr2b Fig. 2 with image from Hernandez et al., 2007
elovl2 Fig. 3 from Pradhan et al., 2018
en2b Fig. S4 with image from Hernandez et al., 2007
esr1 Fig. 3 from Pradhan et al., 2018
esr2a Fig. 3 from Pradhan et al., 2018
esr2b Fig. 3 from Pradhan et al., 2018
gfap Fig. 4 from Pradhan et al., 2018
gper1 Fig. 3 from Pradhan et al., 2018
hoxb1a Fig. S4 with image from Hernandez et al., 2007
hoxd4a Fig. 2 with image from Hernandez et al., 2007
igf1 Fig. 4 from Pradhan et al., 2018
ldlra Fig. 3 from Pradhan et al., 2018
maf1a Fig. 3 from Pradhan et al., 2018
myod1 Fig. 6 with image from Gross-Thebing et al., 2017
nanos3 Fig. 3 with image from Kedde et al., 2007
odc1 Fig. 3 with image from Kedde et al., 2007
pax2a Fig. 2 with image from Hernandez et al., 2007
piwil1 Fig. 1 from Pradhan et al., 2018
Fig. 1 with image from Webster et al., 2017
Fig. 2 with image from Siegfried et al., 2008
pmvk Fig. 3 from Pradhan et al., 2018
pparg Fig. 3 from Pradhan et al., 2018
psen2 Fig. 4 from Pradhan et al., 2018
ptges Fig. 4 from Pradhan et al., 2018
sox9a Fig. 2 with image,  Fig. 4 with image from Siegfried et al., 2008
srebf1 Fig. 3 from Pradhan et al., 2018
thrb Fig. 4 from Pradhan et al., 2018
tnfa Fig. 4 from Pradhan et al., 2018
vtg1 Fig. 3 from Pradhan et al., 2018
vtg2 Fig. 3 from Pradhan et al., 2018
vtg3 Fig. 3 from Pradhan et al., 2018
xiap Fig. 4 from Pradhan et al., 2018
Phenotype
Phenotype resulting from MO1-dnd1
Phenotype Fish Figures
female gonad development aplastic growth, abnormal WT + MO1-dnd1 Fig. 3 with image from Siegfried et al., 2008
female gonad development arrested, abnormal WT + MO1-dnd1 Fig. 3 with image from Siegfried et al., 2008
female organism absent, abnormal WT + MO1-dnd1 Fig. 1 with image from Siegfried et al., 2008
female organism decreased ratio male organism, abnormal WT + MO1-dnd1 Fig. 2 from Pradhan et al., 2018
female sex differentiation absent, abnormal pu5Tg + MO1-dnd1 Fig. 3 with image from Wong et al., 2015
germ cell migration disrupted, abnormal pu5Tg + MO1-dnd1 Fig. 2 with image from Wong et al., 2015
germ line cell absent, abnormal WT + MO1-dnd1 Fig. 1 with image from Webster et al., 2017
Fig. 1 with image from Siegfried et al., 2008
germ line cell DsRed expression mislocalised, abnormal pu5Tg + MO1-dnd1 Fig. 2 with image from Wong et al., 2015
gonad piwil1 expression absent, abnormal WT + MO1-dnd1 Fig. 1 with image from Webster et al., 2017
gonad primordium lacks all parts of type germ line cell, abnormal pu5Tg + MO1-dnd1 Fig. 2 with image from Wong et al., 2015
heart contraction disrupted, abnormal WT + MO1-dnd1 text only from Friedrichs et al., 2009
intestine neoplastic, abnormal WT + MO1-dnd1 Fig. 8 with image from Rodriguez-Mari et al., 2011
male gonad development delayed, abnormal WT + MO1-dnd1 Fig. 3 with image from Siegfried et al., 2008
male gonad development postdisplaced growth, abnormal WT + MO1-dnd1 Fig. 3 with image from Siegfried et al., 2008
male organism male sterile, abnormal WT + MO1-dnd1 Fig. 2 from Pradhan et al., 2018
male organism brain xiap expression decreased amount, abnormal WT + MO1-dnd1 Fig. 4 from Pradhan et al., 2018
male organism brain tnfa expression decreased amount, abnormal WT + MO1-dnd1 Fig. 4 from Pradhan et al., 2018
male organism brain ctnnb1 expression decreased amount, abnormal WT + MO1-dnd1 Fig. 4 from Pradhan et al., 2018
male organism brain dio2 expression decreased amount, abnormal WT + MO1-dnd1 Fig. 4 from Pradhan et al., 2018
male organism brain cyp19a1b expression decreased amount, abnormal WT + MO1-dnd1 Fig. 4 from Pradhan et al., 2018
male organism brain thrb expression decreased amount, abnormal WT + MO1-dnd1 Fig. 4 from Pradhan et al., 2018
male organism brain casp3a expression decreased amount, abnormal WT + MO1-dnd1 Fig. 4 from Pradhan et al., 2018
male organism brain psen2 expression decreased amount, abnormal WT + MO1-dnd1 Fig. 4 from Pradhan et al., 2018
male organism brain ptges expression increased amount, abnormal WT + MO1-dnd1 Fig. 4 from Pradhan et al., 2018
male organism brain apoeb expression increased amount, abnormal WT + MO1-dnd1 Fig. 4 from Pradhan et al., 2018
male organism liver maf1a expression decreased amount, abnormal WT + MO1-dnd1 Fig. 3 from Pradhan et al., 2018
male organism liver gper1 expression decreased amount, abnormal WT + MO1-dnd1 Fig. 3 from Pradhan et al., 2018
male organism liver elovl2 expression decreased amount, abnormal WT + MO1-dnd1 Fig. 3 from Pradhan et al., 2018
male organism liver esr2b expression decreased amount, abnormal WT + MO1-dnd1 Fig. 3 from Pradhan et al., 2018
male organism liver cyp1a expression increased amount, abnormal WT + MO1-dnd1 Fig. 3 from Pradhan et al., 2018
male organism liver srebf1 expression increased amount, abnormal WT + MO1-dnd1 Fig. 3 from Pradhan et al., 2018
male sex differentiation increased occurrence, abnormal pu5Tg + MO1-dnd1 Fig. 3 with image from Wong et al., 2015
ovarian follicle stage I aplastic, abnormal WT + MO1-dnd1 Fig. 3 with image from Siegfried et al., 2008
ovary aplastic, abnormal WT + MO1-dnd1 Fig. 1 with image from Siegfried et al., 2008
primordial germ cell ddx4 expression absent, abnormal AB + MO1-dnd1 Fig. 1 with image from Gross-Thebing et al., 2017
primordial germ cell decreased amount, abnormal AB + MO1-dnd1 Fig. 2 with image from Slanchev et al., 2009
primordial germ cell decreased cellular motility, abnormal WT + MO1-dnd1 Fig. 1 with image,  Fig. 4 with image from Goudarzi et al., 2012
primordial germ cell lacks all parts of type primordial germ cell bleb, abnormal WT + MO1-dnd1 Fig. 1 with image,  Fig. 4 with image from Goudarzi et al., 2012
primordial germ cell mislocalised, abnormal pu5Tg + MO1-dnd1 Fig. 1 with image,  Fig. 2 with image from Gross-Thebing et al., 2017
Fig. 2 with image from Wong et al., 2015
primordial germ cell morphology, abnormal mu7Tg + MO1-dnd1 Fig. 2 with image from Gross-Thebing et al., 2017
primordial germ cell shape, abnormal WT + MO1-dnd1 Fig. 1 with image from Goudarzi et al., 2012
primordial germ cell cell motility decreased occurrence, abnormal WT + MO1-dnd1 Fig. 1 with image,  Fig. 4 with image from Goudarzi et al., 2012
sex determination disrupted, abnormal WT + MO1-dnd1 Fig. 2 from Pradhan et al., 2018
sperm absent, abnormal pu5Tg + MO1-dnd1 Fig. 3 with image from Wong et al., 2015
testis aplastic/hypoplastic, abnormal pu5Tg + MO1-dnd1 Fig. 3 with image from Wong et al., 2015
testis neoplastic, abnormal WT + MO1-dnd1 Fig. 8 with image from Rodriguez-Mari et al., 2011
whole organism sterile, abnormal pu5Tg + MO1-dnd1 Fig. 3 with image from Wong et al., 2015
Phenotype of all Fish created by or utilizing MO1-dnd1
Phenotype Fish Conditions Figures
primordial germ cell decreased amount, abnormal AB + MO1-dnd1 standard conditions Fig. 2 with image from Slanchev et al., 2009
primordial germ cell ddx4 expression absent, abnormal AB + MO1-dnd1 standard conditions Fig. 1 with image from Gross-Thebing et al., 2017
male organism brain casp3a expression decreased amount, abnormal WT + MO1-dnd1 standard conditions Fig. 4 from Pradhan et al., 2018
male organism brain tnfa expression decreased amount, abnormal WT + MO1-dnd1 standard conditions Fig. 4 from Pradhan et al., 2018
male organism brain thrb expression decreased amount, abnormal WT + MO1-dnd1 standard conditions Fig. 4 from Pradhan et al., 2018
male organism liver gper1 expression decreased amount, abnormal WT + MO1-dnd1 standard conditions Fig. 3 from Pradhan et al., 2018
primordial germ cell shape, abnormal WT + MO1-dnd1 standard conditions Fig. 1 with image from Goudarzi et al., 2012
male organism brain psen2 expression decreased amount, abnormal WT + MO1-dnd1 standard conditions Fig. 4 from Pradhan et al., 2018
primordial germ cell lacks all parts of type primordial germ cell bleb, abnormal WT + MO1-dnd1 standard conditions Fig. 1 with image,  Fig. 4 with image from Goudarzi et al., 2012
male organism liver cyp1a expression increased amount, abnormal WT + MO1-dnd1 standard conditions Fig. 3 from Pradhan et al., 2018
sex determination disrupted, abnormal WT + MO1-dnd1 standard conditions Fig. 2 from Pradhan et al., 2018
primordial germ cell cell motility decreased occurrence, abnormal WT + MO1-dnd1 standard conditions Fig. 1 with image,  Fig. 4 with image from Goudarzi et al., 2012
male organism male sterile, abnormal WT + MO1-dnd1 standard conditions Fig. 2 from Pradhan et al., 2018
primordial germ cell decreased cellular motility, abnormal WT + MO1-dnd1 standard conditions Fig. 1 with image,  Fig. 4 with image from Goudarzi et al., 2012
male organism liver srebf1 expression increased amount, abnormal WT + MO1-dnd1 standard conditions Fig. 3 from Pradhan et al., 2018
male gonad development delayed, abnormal WT + MO1-dnd1 standard conditions Fig. 3 with image from Siegfried et al., 2008
male organism brain xiap expression decreased amount, abnormal WT + MO1-dnd1 standard conditions Fig. 4 from Pradhan et al., 2018
male organism brain cyp19a1b expression decreased amount, abnormal WT + MO1-dnd1 standard conditions Fig. 4 from Pradhan et al., 2018
ovary aplastic, abnormal WT + MO1-dnd1 standard conditions Fig. 1 with image from Siegfried et al., 2008
male organism liver elovl2 expression decreased amount, abnormal WT + MO1-dnd1 standard conditions Fig. 3 from Pradhan et al., 2018
ovarian follicle stage I aplastic, abnormal WT + MO1-dnd1 standard conditions Fig. 3 with image from Siegfried et al., 2008
female gonad development aplastic growth, abnormal WT + MO1-dnd1 standard conditions Fig. 3 with image from Siegfried et al., 2008
testis neoplastic, abnormal WT + MO1-dnd1 standard conditions Fig. 8 with image from Rodriguez-Mari et al., 2011
male organism brain dio2 expression decreased amount, abnormal WT + MO1-dnd1 standard conditions Fig. 4 from Pradhan et al., 2018
male organism brain ptges expression increased amount, abnormal WT + MO1-dnd1 standard conditions Fig. 4 from Pradhan et al., 2018
female gonad development arrested, abnormal WT + MO1-dnd1 standard conditions Fig. 3 with image from Siegfried et al., 2008
male organism brain apoeb expression increased amount, abnormal WT + MO1-dnd1 standard conditions Fig. 4 from Pradhan et al., 2018
male gonad development postdisplaced growth, abnormal WT + MO1-dnd1 standard conditions Fig. 3 with image from Siegfried et al., 2008
female organism absent, abnormal WT + MO1-dnd1 standard conditions Fig. 1 with image from Siegfried et al., 2008
male organism liver maf1a expression decreased amount, abnormal WT + MO1-dnd1 standard conditions Fig. 3 from Pradhan et al., 2018
germ line cell absent, abnormal WT + MO1-dnd1 standard conditions Fig. 1 with image from Webster et al., 2017
Fig. 1 with image from Siegfried et al., 2008
gonad piwil1 expression absent, abnormal WT + MO1-dnd1 standard conditions Fig. 1 with image from Webster et al., 2017
male organism liver esr2b expression decreased amount, abnormal WT + MO1-dnd1 standard conditions Fig. 3 from Pradhan et al., 2018
heart contraction disrupted, abnormal WT + MO1-dnd1 standard conditions text only from Friedrichs et al., 2009
female organism decreased ratio male organism, abnormal WT + MO1-dnd1 standard conditions Fig. 2 from Pradhan et al., 2018
male organism brain ctnnb1 expression decreased amount, abnormal WT + MO1-dnd1 standard conditions Fig. 4 from Pradhan et al., 2018
intestine neoplastic, abnormal WT + MO1-dnd1 standard conditions Fig. 8 with image from Rodriguez-Mari et al., 2011
primordial germ cell cell motility decreased occurrence, abnormal WT + MO1-dnd1 + MO4-tp53 standard conditions Fig. 4 with image from Goudarzi et al., 2012
primordial germ cell mislocalised, abnormal mu7Tg + MO1-dnd1 standard conditions Fig. 1 with image,  Fig. 2 with image from Gross-Thebing et al., 2017
primordial germ cell morphology, abnormal mu7Tg + MO1-dnd1 standard conditions Fig. 2 with image from Gross-Thebing et al., 2017
primordial germ cell mislocalised, abnormal pu5Tg + MO1-dnd1 standard conditions Fig. 2 with image from Wong et al., 2015
male sex differentiation increased occurrence, abnormal pu5Tg + MO1-dnd1 standard conditions Fig. 3 with image from Wong et al., 2015
female sex differentiation absent, abnormal pu5Tg + MO1-dnd1 standard conditions Fig. 3 with image from Wong et al., 2015
sperm absent, abnormal pu5Tg + MO1-dnd1 standard conditions Fig. 3 with image from Wong et al., 2015
germ cell migration disrupted, abnormal pu5Tg + MO1-dnd1 standard conditions Fig. 2 with image from Wong et al., 2015
germ line cell DsRed expression mislocalised, abnormal pu5Tg + MO1-dnd1 standard conditions Fig. 2 with image from Wong et al., 2015
testis aplastic/hypoplastic, abnormal pu5Tg + MO1-dnd1 standard conditions Fig. 3 with image from Wong et al., 2015
whole organism sterile, abnormal pu5Tg + MO1-dnd1 standard conditions Fig. 3 with image from Wong et al., 2015
gonad primordium lacks all parts of type germ line cell, abnormal pu5Tg + MO1-dnd1 standard conditions Fig. 2 with image from Wong et al., 2015
primordial germ cell myod1 expression increased amount, abnormal cxcl12at30516/t30516 + MO1-dnd1 standard conditions Fig. 6 with image from Gross-Thebing et al., 2017
primordial germ cell ddx4 expression decreased amount, abnormal cxcl12at30516/t30516 + MO1-dnd1 standard conditions Fig. 6 with image from Gross-Thebing et al., 2017
rhombomere 4 increased size, abnormal cyp26a1rw716/rw716 + MO1-dnd1 standard conditions Fig. 2 with image,  Fig. S4 with image from Hernandez et al., 2007
testis dnd1 expression absent, abnormal dmrt1zm00173004Tg/+ + MO1-dnd1 standard conditions Fig. 6 from Webster et al., 2017
female organism absent, abnormal dmrt1zm00173004Tg/zm00173004Tg + MO1-dnd1 standard conditions Fig. 3 from Webster et al., 2017
male organism increased amount, abnormal dmrt1zm00173004Tg/zm00173004Tg + MO1-dnd1 standard conditions Fig. 3 from Webster et al., 2017
testis dnd1 expression absent, abnormal dmrt1zm00173004Tg/zm00173004Tg + MO1-dnd1 standard conditions Fig. 6 from Webster et al., 2017
testis amh expression absent, abnormal dmrt1zm00173004Tg/zm00173004Tg + MO1-dnd1 standard conditions Fig. 6 from Webster et al., 2017
rhombomere 4 increased size, abnormal cyp26a1rw716/rw716 + MO1-cyp26b1 + MO1-dnd1 standard conditions Fig. 2 with image,  Fig. S4 with image from Hernandez et al., 2007
hindbrain wholly posteriorized, abnormal cyp26a1rw716/rw716 + MO1-cyp26c1 + MO1-dnd1 standard conditions Fig. S4 with image from Hernandez et al., 2007
hindbrain morphology, abnormal cyp26a1rw716/rw716 + MO1-cyp26c1 + MO1-dnd1 standard conditions Fig. 2 with image from Hernandez et al., 2007
rhombomere 4 increased size, abnormal cyp26a1rw716/rw716 + MO1-cyp26c1 + MO1-dnd1 standard conditions Fig. S4 with image from Hernandez et al., 2007
primordial germ cell cell motility decreased speed, abnormal WT + MO1-anxa5b + MO1-dnd1 + MO1-zeb1b + MO3-mylka + MO4-mylka + MO4-tp53 + MO5-mylka standard conditions Fig. 4 with image from Goudarzi et al., 2012
primordial germ cell ddx4 expression absent, abnormal mu7Tg + MO1-dnd1 + MO4-cxcl12a standard conditions Fig. 3 with image from Gross-Thebing et al., 2017
primordial germ cell myod1 expression increased amount, abnormal mu7Tg + MO1-dnd1 + MO4-cxcl12a standard conditions Fig. 3 with image from Gross-Thebing et al., 2017
spermatid absent, abnormal zf45Tg + MO1-dnd1 standard conditions Fig. 1 from Pradhan et al., 2018
germ line cell ddx4 expression decreased amount, abnormal zf45Tg + MO1-dnd1 standard conditions Fig. 1 from Pradhan et al., 2018
male organism male sterile, abnormal zf45Tg + MO1-dnd1 standard conditions Fig. 1 from Pradhan et al., 2018
germ line cell piwil1 expression decreased amount, abnormal zf45Tg + MO1-dnd1 standard conditions Fig. 1 from Pradhan et al., 2018
germ line cell absent, abnormal zf45Tg + MO1-dnd1 standard conditions Fig. 1 from Pradhan et al., 2018
testis decreased mass, abnormal zf45Tg + MO1-dnd1 standard conditions Fig. 1 from Pradhan et al., 2018
primordial germ cell TFP expression increased amount, abnormal ka14Tg; mu6Tg + MO1-dnd1 + MO4-cxcl12a standard conditions Fig. 3 with image,  Fig. 6 with image from Gross-Thebing et al., 2017
primordial germ cell mislocalised, abnormal ka14Tg; mu6Tg + MO1-dnd1 + MO4-cxcl12a standard conditions Fig. 6 with image from Gross-Thebing et al., 2017
primordial germ cell morphology, abnormal ka14Tg; mu6Tg + MO1-dnd1 + MO4-cxcl12a standard conditions Fig. 6 with image from Gross-Thebing et al., 2017
primordial germ cell transformed to somatic cell, abnormal ka14Tg; mu6Tg + MO1-dnd1 + MO4-cxcl12a standard conditions Fig. 6 with image from Gross-Thebing et al., 2017
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.