Morpholino

MO1-wnt5b

ID
ZDB-MRPHLNO-041217-11
Name
MO1-wnt5b
Previous Names
  • wnt5 MO (1)
  • Wnt5-MO (2)
Target
Sequence
5' - GTCCTTGGTTCATTCTCACATCCAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-wnt5b
No data available
Phenotype
Phenotype resulting from MO1-wnt5b
Phenotype Fish Figures
anterior neural plate increased width, abnormal WT + MO1-wnt5b Fig. S7 from Castanon et al., 2013
axial chorda mesoderm decreased length, abnormal WT + MO1-wnt5b Fig. 8 with image from Goudevenou et al., 2011
axis decreased length, abnormal WT + MO1-wnt5b Fig. 6 with image from Goudevenou et al., 2011
Fig. 6 from Zhu et al., 2006
brain morphology, abnormal WT + MO1-wnt5b Fig. 6 with imageFig. 8 with image from Goudevenou et al., 2011
caudal fin morphology, abnormal WT + MO1-wnt5b Figure 7. with image from Hung et al., 2020
cell migration involved in gastrulation disrupted, abnormal WT + MO1-wnt5b Fig. 6 with image from Goudevenou et al., 2011
ceratohyal cartilage mislocalised posteriorly, abnormal WT + MO1-wnt5b Fig. 7 with image from Goudevenou et al., 2011
convergent extension disrupted, abnormal WT + MO1-wnt5b Fig. S7 from Castanon et al., 2013
convergent extension spatial distribution of a process, abnormal WT + MO1-wnt5b Figure 7. with imageFigure 8. with imageFigure 9. with image from Hung et al., 2020
convergent extension involved in axis elongation disrupted, abnormal WT + MO1-wnt5b Fig. 3 from Zhang et al., 2006
convergent extension involved in gastrulation disrupted, abnormal WT + MO1-wnt5b Fig. 2 with image from Jopling et al., 2007
Fig. 6 from Zhu et al., 2006
Fig. 5 from Jopling et al., 2005
Fig. 5 from Kilian et al., 2003
convergent extension involved in gastrulation normal process quality, abnormal AB/TU + MO1-wnt5b Figure 5 with image from Saraswathy et al., 2022
convergent extension involved in neural plate elongation disrupted, abnormal WT + MO1-wnt5b Fig. 8 with image from Goudevenou et al., 2011
cranial cartilage morphology, abnormal WT + MO1-wnt5b Fig. 2 with image from Jopling et al., 2007
Fig. 1 from Lele et al., 2001
ectodermal cell circular, abnormal WT + MO1-wnt5b Fig. 3 from Kilian et al., 2003
ectodermal cell cell projection spatial deviation, abnormal WT + MO1-wnt5b Fig. 3 from Kilian et al., 2003
epiblast actin cap position, abnormal WT + MO1-wnt5b Fig. 7 from Castanon et al., 2013
epiblast establishment of mitotic spindle orientation disrupted, abnormal WT + MO1-wnt5b Fig. 2 with image from Castanon et al., 2020
epiblast mitotic spindle disorganized, abnormal WT + MO1-wnt5b Fig. 2 with image from Castanon et al., 2020
epiboly arrested, abnormal WT + MO1-wnt5b Figure 7. with image from Hung et al., 2020
epiboly delayed, abnormal WT + MO1-wnt5b Figure 7. with image from Hung et al., 2020
eye increased distance eye, abnormal WT + MO1-wnt5b Fig. 7 with image from Goudevenou et al., 2011
head condensed, abnormal WT + MO1-wnt5b Fig. 1 from Lele et al., 2001
head anterior region flattened, abnormal WT + MO1-wnt5b Fig. 7 with image from Goudevenou et al., 2011
hypoblast cell circular, abnormal WT + MO1-wnt5b Fig. 3 from Kilian et al., 2003
hypoblast cell projection spatial deviation, abnormal WT + MO1-wnt5b Fig. 3 from Kilian et al., 2003
lymphangioblast cord decreased length, abnormal y1Tg + MO1-wnt5b Fig. 4 from Nicenboim et al., 2015
Meckel's cartilage decreased length, abnormal WT + MO1-wnt5b Fig. 7 with image from Goudevenou et al., 2011
Meckel's cartilage shape, abnormal WT + MO1-wnt5b Fig. 7 with image from Goudevenou et al., 2011
neural plate increased width, abnormal WT + MO1-wnt5b Fig. 8 with image from Goudevenou et al., 2011
notochord decreased length, abnormal WT + MO1-wnt5b Fig. S7 from Castanon et al., 2013
Fig. 6 from Zhu et al., 2006
Fig. 5 from Kilian et al., 2003
notochord increased width, abnormal WT + MO1-wnt5b Fig. S7 from Castanon et al., 2013
Fig. 6 from Zhu et al., 2006
Fig. 5 from Kilian et al., 2003
notochord undulate, abnormal WT + MO1-wnt5b Fig. 1 from Lele et al., 2001
otolith deformed, abnormal AB + MO1-wnt5b Fig. 5 from Louwette et al., 2012
post-anal tail morphogenesis disrupted, abnormal WT + MO1-wnt5b Fig. 3 from Zhang et al., 2006
post-vent region decreased length, abnormal WT + MO1-wnt5b Fig. 3 from Zhang et al., 2006
Fig. 1 from Lele et al., 2001
post-vent region undulate, abnormal WT + MO1-wnt5b Fig. 7 with image from Pei et al., 2009
posterior cardinal vein vascular lymphangioblast decreased amount, abnormal nim5Tg; y7Tg + MO1-wnt5b Fig. 5 from Nicenboim et al., 2015
posterior lateral line neuromast decreased amount, abnormal AB + MO1-wnt5b Fig. 5 from Louwette et al., 2012
protein localization disrupted, abnormal WT + MO1-wnt5b Fig. 1 from Castanon et al., 2013
somite morphology, abnormal WT + MO1-wnt5b Fig. 6 with imageFig. 8 with image from Goudevenou et al., 2011
tail bud truncated, abnormal WT + MO1-wnt5b Fig. 6 with imageFig. 8 with image from Goudevenou et al., 2011
thrombocyte decreased amount, abnormal AB + MO1-wnt5b Fig. 5 from Louwette et al., 2012
unidimensional cell growth disrupted, abnormal WT + MO1-wnt5b Fig. 3 from Kilian et al., 2003
whole organism ptk2ab expression decreased amount, abnormal WT + MO1-wnt5b Figure 7. with image from Hung et al., 2020
whole organism rac1l expression decreased amount, abnormal WT + MO1-wnt5b Figure 9. with image from Hung et al., 2020
whole organism cdc42 expression decreased amount, abnormal WT + MO1-wnt5b Figure 9. with image from Hung et al., 2020
whole organism decreased length, abnormal WT + MO1-wnt5b Fig. S7 from Castanon et al., 2013
Fig. 7 with image from Pei et al., 2009
whole organism morphology, abnormal WT + MO1-wnt5b Fig. 2 with image from Young et al., 2014
whole organism anterior region morphology, abnormal WT + MO1-wnt5b Fig. 5 from Jopling et al., 2005
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-wnt5b Fig. 6 with imageFig. 8 with image from Goudevenou et al., 2011
Fig. 5 from Jopling et al., 2005
Fig. 1 from Lele et al., 2001
whole organism axis decreased length, abnormal WT + MO1-wnt5b Figure 7. with image from Hung et al., 2020
whole organism left-right axis increased width, abnormal WT + MO1-wnt5b Fig. 5 from Jopling et al., 2005
Fig. 1 from Lele et al., 2001
whole organism positive regulation of serine C-palmitoyltransferase activity decreased occurrence, abnormal WT + MO1-wnt5b Fig. 2 with image from Castanon et al., 2020
whole organism sphinganine biosynthetic process decreased rate, abnormal WT + MO1-wnt5b Fig. 2 with image from Castanon et al., 2020
whole organism sphingosine biosynthetic process decreased rate, abnormal WT + MO1-wnt5b Fig. 2 with image from Castanon et al., 2020
Phenotype of all Fish created by or utilizing MO1-wnt5b
Phenotype Fish Conditions Figures
otolith deformed, abnormal AB + MO1-wnt5b standard conditions Fig. 5 from Louwette et al., 2012
thrombocyte decreased amount, abnormal AB + MO1-wnt5b standard conditions Fig. 5 from Louwette et al., 2012
posterior lateral line neuromast decreased amount, abnormal AB + MO1-wnt5b standard conditions Fig. 5 from Louwette et al., 2012
convergent extension involved in gastrulation normal process quality, abnormal AB/TU + MO1-wnt5b standard conditions Figure 5 with image from Saraswathy et al., 2022
notochord decreased length, abnormal WT + MO1-wnt5b standard conditions Fig. S7 from Castanon et al., 2013
Fig. 6 from Zhu et al., 2006
Fig. 5 from Kilian et al., 2003
convergent extension involved in neural plate elongation disrupted, abnormal WT + MO1-wnt5b standard conditions Fig. 8 with image from Goudevenou et al., 2011
axial chorda mesoderm decreased length, abnormal WT + MO1-wnt5b standard conditions Fig. 8 with image from Goudevenou et al., 2011
eye increased distance eye, abnormal WT + MO1-wnt5b standard conditions Fig. 7 with image from Goudevenou et al., 2011
whole organism morphology, abnormal WT + MO1-wnt5b standard conditions Fig. 2 with image from Young et al., 2014
notochord increased width, abnormal WT + MO1-wnt5b standard conditions Fig. S7 from Castanon et al., 2013
Fig. 6 from Zhu et al., 2006
Fig. 5 from Kilian et al., 2003
ceratohyal cartilage mislocalised posteriorly, abnormal WT + MO1-wnt5b standard conditions Fig. 7 with image from Goudevenou et al., 2011
epiboly delayed, abnormal WT + MO1-wnt5b standard conditions Figure 7. with image from Hung et al., 2020
post-vent region undulate, abnormal WT + MO1-wnt5b standard conditions Fig. 7 with image from Pei et al., 2009
convergent extension involved in gastrulation disrupted, abnormal WT + MO1-wnt5b standard conditions Fig. 2 with image from Jopling et al., 2007
Fig. 6 from Zhu et al., 2006
Fig. 5 from Jopling et al., 2005
Fig. 5 from Kilian et al., 2003
whole organism anterior region morphology, abnormal WT + MO1-wnt5b standard conditions Fig. 5 from Jopling et al., 2005
brain morphology, abnormal WT + MO1-wnt5b standard conditions Fig. 6 with imageFig. 8 with image from Goudevenou et al., 2011
anterior neural plate increased width, abnormal WT + MO1-wnt5b standard conditions Fig. S7 from Castanon et al., 2013
epiboly arrested, abnormal WT + MO1-wnt5b standard conditions Figure 7. with image from Hung et al., 2020
ectodermal cell cell projection spatial deviation, abnormal WT + MO1-wnt5b standard conditions Fig. 3 from Kilian et al., 2003
head anterior region flattened, abnormal WT + MO1-wnt5b standard conditions Fig. 7 with image from Goudevenou et al., 2011
whole organism sphingosine biosynthetic process decreased rate, abnormal WT + MO1-wnt5b standard conditions Fig. 2 with image from Castanon et al., 2020
head condensed, abnormal WT + MO1-wnt5b standard conditions Fig. 1 from Lele et al., 2001
whole organism ptk2ab expression decreased amount, abnormal WT + MO1-wnt5b standard conditions Figure 7. with image from Hung et al., 2020
post-vent region decreased length, abnormal WT + MO1-wnt5b standard conditions Fig. 3 from Zhang et al., 2006
Fig. 1 from Lele et al., 2001
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-wnt5b standard conditions Fig. 6 with imageFig. 8 with image from Goudevenou et al., 2011
Fig. 5 from Jopling et al., 2005
Fig. 1 from Lele et al., 2001
whole organism axis decreased length, abnormal WT + MO1-wnt5b standard conditions Figure 7. with image from Hung et al., 2020
cranial cartilage morphology, abnormal WT + MO1-wnt5b standard conditions Fig. 2 with image from Jopling et al., 2007
Fig. 1 from Lele et al., 2001
convergent extension disrupted, abnormal WT + MO1-wnt5b standard conditions Fig. S7 from Castanon et al., 2013
neural plate increased width, abnormal WT + MO1-wnt5b standard conditions Fig. 8 with image from Goudevenou et al., 2011
epiblast establishment of mitotic spindle orientation disrupted, abnormal WT + MO1-wnt5b standard conditions Fig. 2 with image from Castanon et al., 2020
notochord undulate, abnormal WT + MO1-wnt5b standard conditions Fig. 1 from Lele et al., 2001
axis decreased length, abnormal WT + MO1-wnt5b standard conditions Fig. 6 with image from Goudevenou et al., 2011
Fig. 6 from Zhu et al., 2006
caudal fin morphology, abnormal WT + MO1-wnt5b standard conditions Figure 7. with image from Hung et al., 2020
tail bud truncated, abnormal WT + MO1-wnt5b standard conditions Fig. 6 with imageFig. 8 with image from Goudevenou et al., 2011
hypoblast cell circular, abnormal WT + MO1-wnt5b standard conditions Fig. 3 from Kilian et al., 2003
post-anal tail morphogenesis disrupted, abnormal WT + MO1-wnt5b standard conditions Fig. 3 from Zhang et al., 2006
epiblast mitotic spindle disorganized, abnormal WT + MO1-wnt5b standard conditions Fig. 2 with image from Castanon et al., 2020
epiblast actin cap position, abnormal WT + MO1-wnt5b standard conditions Fig. 7 from Castanon et al., 2013
whole organism left-right axis increased width, abnormal WT + MO1-wnt5b standard conditions Fig. 5 from Jopling et al., 2005
Fig. 1 from Lele et al., 2001
unidimensional cell growth disrupted, abnormal WT + MO1-wnt5b standard conditions Fig. 3 from Kilian et al., 2003
convergent extension involved in axis elongation disrupted, abnormal WT + MO1-wnt5b standard conditions Fig. 3 from Zhang et al., 2006
whole organism decreased length, abnormal WT + MO1-wnt5b standard conditions Fig. S7 from Castanon et al., 2013
Fig. 7 with image from Pei et al., 2009
hypoblast cell projection spatial deviation, abnormal WT + MO1-wnt5b standard conditions Fig. 3 from Kilian et al., 2003
cell migration involved in gastrulation disrupted, abnormal WT + MO1-wnt5b standard conditions Fig. 6 with image from Goudevenou et al., 2011
whole organism positive regulation of serine C-palmitoyltransferase activity decreased occurrence, abnormal WT + MO1-wnt5b standard conditions Fig. 2 with image from Castanon et al., 2020
Meckel's cartilage decreased length, abnormal WT + MO1-wnt5b standard conditions Fig. 7 with image from Goudevenou et al., 2011
whole organism rac1l expression decreased amount, abnormal WT + MO1-wnt5b standard conditions Figure 9. with image from Hung et al., 2020
somite morphology, abnormal WT + MO1-wnt5b standard conditions Fig. 6 with imageFig. 8 with image from Goudevenou et al., 2011
whole organism sphinganine biosynthetic process decreased rate, abnormal WT + MO1-wnt5b standard conditions Fig. 2 with image from Castanon et al., 2020
whole organism cdc42 expression decreased amount, abnormal WT + MO1-wnt5b standard conditions Figure 9. with image from Hung et al., 2020
convergent extension spatial distribution of a process, abnormal WT + MO1-wnt5b standard conditions Figure 7. with imageFigure 8. with imageFigure 9. with image from Hung et al., 2020
Meckel's cartilage shape, abnormal WT + MO1-wnt5b standard conditions Fig. 7 with image from Goudevenou et al., 2011
ectodermal cell circular, abnormal WT + MO1-wnt5b standard conditions Fig. 3 from Kilian et al., 2003
protein localization disrupted, abnormal WT + MO1-wnt5b standard conditions Fig. 1 from Castanon et al., 2013
lymphangioblast cord decreased length, abnormal y1Tg + MO1-wnt5b standard conditions Fig. 4 from Nicenboim et al., 2015
posterior cardinal vein vascular lymphangioblast decreased amount, abnormal nim5Tg; y7Tg + MO1-wnt5b standard conditions Fig. 5 from Nicenboim et al., 2015
convergent extension involved in gastrulation decreased process quality, exacerbated mib1tfi91/tfi91 + MO1-wnt5b standard conditions Figure 5 with image from Saraswathy et al., 2022
whole organism decreased length, abnormal ndr1hi975Tg/hi975Tg + MO1-wnt5b standard conditions Fig. 7 with image from Pei et al., 2009
trunk anterior-posterior axis bifurcated, abnormal ndr1hi975Tg/hi975Tg + MO1-wnt5b standard conditions Fig. 7 with image from Pei et al., 2009
post-vent region undulate, abnormal ndr1hi975Tg/hi975Tg + MO1-wnt5b standard conditions Fig. 7 with image from Pei et al., 2009
trunk duplicated, abnormal ndr1hi975Tg/hi975Tg + MO1-wnt5b standard conditions Fig. 7 with image from Pei et al., 2009
convergent extension spatial distribution of a process, abnormal ptk2abtwu0103/twu0103 + MO1-wnt5b standard conditions Figure 10. with image from Hung et al., 2020
trunk duplicated, abnormal tdgf1tz257/tz257 + MO1-wnt5b standard conditions Fig. 7 with image from Pei et al., 2009
eye malformed, abnormal tdgf1tz257/tz257 + MO1-wnt5b standard conditions Fig. 7 with image from Pei et al., 2009
trunk anterior-posterior axis bifurcated, abnormal tdgf1tz257/tz257 + MO1-wnt5b standard conditions Fig. 7 with image from Pei et al., 2009
eye mislocalised, abnormal tdgf1tz257/tz257 + MO1-wnt5b standard conditions Fig. 7 with image from Pei et al., 2009
eye decreased amount, abnormal tdgf1tz257/tz257 + MO1-wnt5b standard conditions Fig. 7 with image from Pei et al., 2009
convergent extension involved in gastrulation decreased process quality, abnormal AB/TU + MO1-mib1 + MO1-wnt5b standard conditions Figure 5 with image from Saraswathy et al., 2022
convergent extension involved in axis elongation disrupted, abnormal TL + MO1-porcn + MO1-wnt5b standard conditions Fig. 4 from Chen et al., 2012
post-anal tail morphogenesis disrupted, abnormal WT + MO1-metap2b + MO1-wnt5b standard conditions Fig. 3 from Zhang et al., 2006
post-vent region decreased length, abnormal WT + MO1-metap2b + MO1-wnt5b standard conditions Fig. 3 from Zhang et al., 2006
somite increased width, abnormal WT + MO1-metap2b + MO1-wnt5b standard conditions Fig. 3 from Zhang et al., 2006
convergent extension involved in axis elongation disrupted, abnormal WT + MO1-metap2b + MO1-wnt5b standard conditions Fig. 3 from Zhang et al., 2006
notochord decreased length, abnormal WT + MO1-wnt5b + MO2-fzd2 + MO3-fzd2 standard conditions Fig. 5 from Kilian et al., 2003
convergent extension involved in gastrulation disrupted, abnormal WT + MO1-wnt5b + MO2-fzd2 + MO3-fzd2 standard conditions Fig. 5 from Kilian et al., 2003
eye increased distance eye, abnormal WT + MO1-wnt5b + MO2-ptpn11a standard conditions Fig. S2 with image from Jopling et al., 2007
cranial cartilage morphology, abnormal WT + MO1-wnt5b + MO2-ptpn11a standard conditions Fig. S2 with image from Jopling et al., 2007
notochord decreased length, abnormal WT + MO1-wnt5b + MO3-antxr2a standard conditions Fig. S7 from Castanon et al., 2013
convergent extension disrupted, abnormal WT + MO1-wnt5b + MO3-antxr2a standard conditions Fig. S7 from Castanon et al., 2013
prechordal plate elongated, abnormal WT + MO1-wnt5b + MO3-antxr2a standard conditions Fig. S7 from Castanon et al., 2013
whole organism decreased length, abnormal WT + MO1-wnt5b + MO3-antxr2a standard conditions Fig. S7 from Castanon et al., 2013
anterior neural plate increased width, abnormal WT + MO1-wnt5b + MO3-antxr2a standard conditions Fig. S7 from Castanon et al., 2013
notochord increased width, abnormal WT + MO1-wnt5b + MO3-antxr2a standard conditions Fig. S7 from Castanon et al., 2013
somite condensed, abnormal WT + MO1-wnt11f2 + MO1-wnt5b standard conditions Fig. 1 with image from Moeller et al., 2006
convergent extension involved in axis elongation disrupted, abnormal WT + MO1-wnt11f2 + MO1-wnt5b standard conditions Fig. 1 with image from Moeller et al., 2006
whole organism decreased length, abnormal WT + MO1-wnt11f2 + MO1-wnt5b standard conditions Fig. 1 with image from Moeller et al., 2006
somite increased width, abnormal WT + MO1-wnt11f2 + MO1-wnt5b standard conditions Fig. 1 with image from Moeller et al., 2006
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-fyna,fynb + MO1-wnt5b + MO1-yes1 standard conditions Fig. 5 from Jopling et al., 2005
Citations