CRISPR

CRISPR1-ada2b

ID
ZDB-CRISPR-250102-11
Name
CRISPR1-ada2b
Previous Names
None
Target
Sequence
5' - TTCTGTTTAGGCATATGAAC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The PAM site was "TGG" at the 3' end.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
No data available
Expression
Gene expression in Wild Types + CRISPR1-ada2b
No data available
Phenotype
Phenotype resulting from CRISPR1-ada2b
No data available
Phenotype of all Fish created by or utilizing CRISPR1-ada2b
Phenotype Fish Conditions Figures
hematopoietic multipotent progenitor cell EGFP expression amount, ameliorated la2Tg/la2Tg + CRISPR1-ada2b + CRISPR2-ada2b chemical treatment by environment: N-[2-(4-bromocinnamylamino)ethyl]isoquinoline-5-sulfonamide Fig. 4 with image from Brix et al., 2024
caudal hematopoietic tissue cell division decreased rate of occurrence, abnormal la2Tg/la2Tg + CRISPR1-ada2b + CRISPR2-ada2b standard conditions Fig. 6 with image from Brix et al., 2024
caudal hematopoietic tissue decreased amount, abnormal la2Tg/la2Tg + CRISPR1-ada2b + CRISPR2-ada2b standard conditions Fig. 6 with image from Brix et al., 2024
caudal vein plexus EGFP expression decreased amount, abnormal la2Tg/la2Tg + CRISPR1-ada2b + CRISPR2-ada2b standard conditions Fig. 3 with image from Brix et al., 2024
hematopoietic multipotent progenitor cell EGFP expression decreased amount, abnormal la2Tg/la2Tg + CRISPR1-ada2b + CRISPR2-ada2b standard conditions Fig. 4 with image from Brix et al., 2024
caudal hematopoietic tissue neutrophil decreased amount, abnormal la2Tg/la2Tg + CRISPR1-ada2b + CRISPR2-ada2b standard conditions Fig. 5 with imageFig. 6 with image from Brix et al., 2024
caudal hematopoietic tissue EGFP expression decreased amount, abnormal la2Tg/la2Tg + CRISPR1-ada2b + CRISPR2-ada2b standard conditions Fig. 5 with imageFig. 6 with image from Brix et al., 2024
caudal vein plexus anterior side EGFP expression decreased amount, abnormal s843Tg/s843Tg + CRISPR1-ada2b + CRISPR2-ada2b standard conditions Fig. 3 with image from Brix et al., 2024
caudal vein plexus posterior side EGFP expression decreased amount, abnormal s843Tg/s843Tg + CRISPR1-ada2b + CRISPR2-ada2b standard conditions Fig. 3 with image from Brix et al., 2024
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell EGFP expression increased amount, abnormal s843Tg/s843Tg + CRISPR1-ada2b + CRISPR2-ada2b standard conditions Fig. 3 with image from Brix et al., 2024
whole organism tnfa expression increased amount, abnormal ump5Tg/ump5Tg + CRISPR1-ada2b + CRISPR2-ada2b standard conditions Fig. 1 with image from Brix et al., 2024
trunk neutrophil EGFP expression increased amount, abnormal ump5Tg/ump5Tg + CRISPR1-ada2b + CRISPR2-ada2b standard conditions Fig. 1 with image from Brix et al., 2024
whole organism il1b expression increased amount, abnormal ump5Tg/ump5Tg + CRISPR1-ada2b + CRISPR2-ada2b standard conditions Fig. 1 with image from Brix et al., 2024
whole organism il10 expression decreased amount, abnormal ump5Tg/ump5Tg + CRISPR1-ada2b + CRISPR2-ada2b standard conditions Fig. 1 with image from Brix et al., 2024
caudal hematopoietic tissue neutrophil decreased amount, abnormal ump5Tg/ump5Tg + CRISPR1-ada2b + CRISPR2-ada2b standard conditions Fig. 1 with image from Brix et al., 2024
posterior cardinal vein ephb4a expression decreased amount, abnormal y1Tg/y1Tg + CRISPR1-ada2b + CRISPR2-ada2b standard conditions Fig. 2 with image from Brix et al., 2024
endothelial cell il1b expression amount, ameliorated y1Tg/y1Tg + CRISPR1-ada2b + CRISPR2-ada2b chemical treatment by environment: CGS 15943 Fig. 5 with image from Brix et al., 2024
hematopoietic multipotent progenitor cell myb expression amount, ameliorated y1Tg/y1Tg + CRISPR1-ada2b + CRISPR2-ada2b chemical treatment by environment: CGS 15943 Fig. 2 with image from Brix et al., 2024
endothelial cell tnfa expression amount, ameliorated y1Tg/y1Tg + CRISPR1-ada2b + CRISPR2-ada2b chemical treatment by environment: CGS 15943 Fig. 5 with image from Brix et al., 2024
endothelial cell cxcl8a expression amount, ameliorated y1Tg/y1Tg + CRISPR1-ada2b + CRISPR2-ada2b chemical treatment by environment: CGS 15943 Fig. 2 with image from Brix et al., 2024
posterior cardinal vein ephb4a expression amount, ameliorated y1Tg/y1Tg + CRISPR1-ada2b + CRISPR2-ada2b chemical treatment by environment: CGS 15943 Fig. 2 with image from Brix et al., 2024
endothelial cell myb expression amount, ameliorated y1Tg/y1Tg + CRISPR1-ada2b + CRISPR2-ada2b chemical treatment by environment: CGS 15943 Fig. 2 with image from Brix et al., 2024
endothelial cell myb expression increased amount, abnormal y1Tg/y1Tg + CRISPR1-ada2b + CRISPR2-ada2b standard conditions Fig. 2 with image from Brix et al., 2024
endothelial cell cxcl8a expression increased amount, abnormal y1Tg/y1Tg + CRISPR1-ada2b + CRISPR2-ada2b standard conditions Fig. 2 with image from Brix et al., 2024
ventral wall of dorsal aorta runx1 expression amount, ameliorated y1Tg/y1Tg + CRISPR1-ada2b + CRISPR2-ada2b chemical treatment by environment: CGS 15943 Fig. 2 with image from Brix et al., 2024
hematopoietic multipotent progenitor cell myb expression increased amount, abnormal y1Tg/y1Tg + CRISPR1-ada2b + CRISPR2-ada2b standard conditions Fig. 2 with image from Brix et al., 2024
endothelial cell il1b expression increased amount, abnormal y1Tg/y1Tg + CRISPR1-ada2b + CRISPR2-ada2b standard conditions Fig. 5 with image from Brix et al., 2024
ventral wall of dorsal aorta tal1 expression increased amount, abnormal y1Tg/y1Tg + CRISPR1-ada2b + CRISPR2-ada2b standard conditions Fig. 2 with image from Brix et al., 2024
ventral wall of dorsal aorta tal1 expression amount, ameliorated y1Tg/y1Tg + CRISPR1-ada2b + CRISPR2-ada2b chemical treatment by environment: CGS 15943 Fig. 2 with image from Brix et al., 2024
dorsal aorta efnb2a expression decreased amount, abnormal y1Tg/y1Tg + CRISPR1-ada2b + CRISPR2-ada2b standard conditions Fig. 2 with image from Brix et al., 2024
ventral wall of dorsal aorta runx1 expression increased amount, abnormal y1Tg/y1Tg + CRISPR1-ada2b + CRISPR2-ada2b standard conditions Fig. 2 with image from Brix et al., 2024
dorsal aorta efnb2a expression amount, ameliorated y1Tg/y1Tg + CRISPR1-ada2b + CRISPR2-ada2b chemical treatment by environment: CGS 15943 Fig. 2 with image from Brix et al., 2024
endothelial cell tnfa expression increased amount, abnormal y1Tg/y1Tg + CRISPR1-ada2b + CRISPR2-ada2b standard conditions Fig. 5 with image from Brix et al., 2024
caudal hematopoietic tissue EGFP expression amount, ameliorated la2Tg/la2Tg + CRISPR1-ada2b + CRISPR2-ada2b + MO1-tnfa standard conditions Fig. 5 with image from Brix et al., 2024
caudal hematopoietic tissue neutrophil decreased amount, ameliorated la2Tg/la2Tg + CRISPR1-ada2b + CRISPR2-ada2b + MO1-tnfa standard conditions Fig. 5 with image from Brix et al., 2024
Citations