CRISPR

CRISPR2-hoxc13a

ID
ZDB-CRISPR-211130-13
Name
CRISPR2-hoxc13a
Previous Names
  • CRISPR2-hoxc13b
Target
Sequence
5' - CCATGGAGGGCTATCAACAC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genome Build: GRCz11Chromosome: 23
Constructs
No data available
Genomic Features
Expression
Gene expression in Wild Types + CRISPR2-hoxc13a
No data available
Phenotype
Phenotype resulting from CRISPR2-hoxc13a
No data available
Phenotype of all Fish created by or utilizing CRISPR2-hoxc13a
Phenotype Fish Conditions Figures
vertebra 16 transformed to vertebra 15, abnormal Df(Chr23:hoxc13a,hoxc12a,hoxc11a,hoxc10a,hoxc9a,hoxc8a,hoxc6a,hoxc5a,hoxc4a,hoxc3a,hoxc1a)sud115/sud115 (RW) standard conditions Fig. 4 with image from Yamada et al., 2021
tripus transformed to parapophysis 2, abnormal Df(Chr23:hoxc13a,hoxc12a,hoxc11a,hoxc10a,hoxc9a,hoxc8a,hoxc6a,hoxc5a,hoxc4a,hoxc3a,hoxc1a)sud115/sud115 (RW) standard conditions Fig. 4 with image from Yamada et al., 2021
vertebra 15 transformed to vertebra 14, abnormal Df(Chr23:hoxc13a,hoxc12a,hoxc11a,hoxc10a,hoxc9a,hoxc8a,hoxc6a,hoxc5a,hoxc4a,hoxc3a,hoxc1a)sud115/sud115 (RW) standard conditions Fig. 4 with image from Yamada et al., 2021
swim bladder morphology, abnormal Df(Chr23:hoxc13a,hoxc12a,hoxc11a,hoxc10a,hoxc9a,hoxc8a,hoxc6a,hoxc5a,hoxc4a,hoxc3a,hoxc1a)sud115/sud115 (RW) standard conditions Fig. 6 with image from Yamada et al., 2021
somite increased amount, abnormal Df(Chr23:hoxc13a,hoxc12a,hoxc11a,hoxc10a,hoxc9a,hoxc8a,hoxc6a,hoxc5a,hoxc4a,hoxc3a,hoxc1a)sud115/sud115 (RW) standard conditions Fig. 5 with image from Yamada et al., 2021
os suspensorium absent, abnormal Df(Chr23:hoxc13a,hoxc12a,hoxc11a,hoxc10a,hoxc9a,hoxc8a,hoxc6a,hoxc5a,hoxc4a,hoxc3a,hoxc1a)sud115/sud115 (RW) standard conditions Fig. 4 with image from Yamada et al., 2021
whole organism semi-viable, abnormal Df(Chr23:hoxc13a,hoxc12a,hoxc11a,hoxc10a,hoxc9a,hoxc8a,hoxc6a,hoxc5a,hoxc4a,hoxc3a,hoxc1a)sud115/sud115 (RW) standard conditions Table 1 from Yamada et al., 2021
vertebra increased amount, abnormal Df(Chr23:hoxc13a,hoxc12a,hoxc11a,hoxc10a,hoxc9a,hoxc8a,hoxc6a,hoxc5a,hoxc4a,hoxc3a,hoxc1a)sud115/sud115 (RW) standard conditions Fig. 5 with image from Yamada et al., 2021
somite border increased amount, abnormal Df(Chr23:hoxc13a,hoxc12a,hoxc11a,hoxc10a,hoxc9a,hoxc8a,hoxc6a,hoxc5a,hoxc4a,hoxc3a,hoxc1a)sud115/sud115 (RW) standard conditions Fig. 5 with image from Yamada et al., 2021
vertebra increased amount, abnormal hoxc13asud133b/sud133b; hoxc13bsud134b/sud134b standard conditions Fig. 2 with image from Adachi et al., 2024
tripus anterior region decreased length, abnormal hoxc11bsud124b/sud124b; hoxc12bsud124c/sud124c; hoxc13bsud124d/sud124d; hoxc6bsud124a/sud124a (RW) standard conditions Fig. 4 with image from Yamada et al., 2021
anal fin lepidotrichium increased amount, exacerbated hoxc12asud133a/sud133a; hoxc12bsud134a/sud134a; hoxc13asud133b/sud133b; hoxc13bsud134b/sud134b standard conditions Fig. 2 with image from Adachi et al., 2024
vertebra increased amount, abnormal hoxc12asud133a/sud133a; hoxc12bsud134a/sud134a; hoxc13asud133b/sud133b; hoxc13bsud134b/sud134b standard conditions Fig. 2 with image from Adachi et al., 2024
ventral fin fold posterior orientation, abnormal hoxc12asud133a/sud133a; hoxc12bsud134a/sud134a; hoxc13asud133b/sud133b; hoxc13bsud134b/sud134b standard conditions Fig. 2 with image from Adachi et al., 2024
anal fin radial increased amount, exacerbated hoxc12asud133a/sud133a; hoxc12bsud134a/sud134a; hoxc13asud133b/sud133b; hoxc13bsud134b/sud134b standard conditions Fig. 2 with image from Adachi et al., 2024
vertebra increased amount, abnormal hoxc12asud133a/sud133a; hoxc11asud141/sud141; hoxc11bsud128/sud128; hoxc12bsud134a/sud134a; hoxc13asud133b/sud133b; hoxc13bsud134b/sud134b standard conditions Fig. 3 with image from Adachi et al., 2024
dorsal fin lepidotrichium increased amount, exacerbated hoxc12asud133a/sud133a; hoxc11asud141/sud141; hoxc11bsud128/sud128; hoxc12bsud134a/sud134a; hoxc13asud133b/sud133b; hoxc13bsud134b/sud134b standard conditions Fig. 3 with image from Adachi et al., 2024
anal fin radial increased amount, abnormal hoxc6bsud124a/+; Df(Chr23:hoxc13a,hoxc12a,hoxc11a,hoxc10a,hoxc9a,hoxc8a,hoxc6a,hoxc5a,hoxc4a,hoxc3a,hoxc1a)sud115/sud115 standard conditions Fig. 1 with image from Adachi et al., 2024
abdominal musculature posterior region increased amount, abnormal hoxc6bsud124a/+; Df(Chr23:hoxc13a,hoxc12a,hoxc11a,hoxc10a,hoxc9a,hoxc8a,hoxc6a,hoxc5a,hoxc4a,hoxc3a,hoxc1a)sud115/sud115 standard conditions Fig. 1 with image from Adachi et al., 2024
whole organism posterior region increased height, abnormal hoxc6bsud124a/+; Df(Chr23:hoxc13a,hoxc12a,hoxc11a,hoxc10a,hoxc9a,hoxc8a,hoxc6a,hoxc5a,hoxc4a,hoxc3a,hoxc1a)sud115/sud115 standard conditions Fig. 1 with image from Adachi et al., 2024
anal fin lepidotrichium increased amount, abnormal hoxc6bsud124a/+; Df(Chr23:hoxc13a,hoxc12a,hoxc11a,hoxc10a,hoxc9a,hoxc8a,hoxc6a,hoxc5a,hoxc4a,hoxc3a,hoxc1a)sud115/sud115 standard conditions Fig. 1 with image from Adachi et al., 2024
Citations