CRISPR

CRISPR2-hoxc13a

ID
ZDB-CRISPR-211130-13
Name
CRISPR2-hoxc13a
Previous Names
  • CRISPR2-hoxc13b
Target
Sequence
5' - CCATGGAGGGCTATCAACAC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Expression
Gene expression in Wild Types + CRISPR2-hoxc13a
No data available
Phenotype
Phenotype resulting from CRISPR2-hoxc13a
No data available
Phenotype of all Fish created by or utilizing CRISPR2-hoxc13a
Phenotype Fish Conditions Figures
vertebra 16 transformed to vertebra 15, abnormal Df(Chr23:hoxc13a,hoxc12a,hoxc11a,hoxc10a,hoxc9a,hoxc8a,hoxc6a,hoxc5a,hoxc4a,hoxc3a,hoxc1a)sud115/sud115 (RW) standard conditions Fig. 4 with image from Yamada et al., 2021
tripus transformed to parapophysis 2, abnormal Df(Chr23:hoxc13a,hoxc12a,hoxc11a,hoxc10a,hoxc9a,hoxc8a,hoxc6a,hoxc5a,hoxc4a,hoxc3a,hoxc1a)sud115/sud115 (RW) standard conditions Fig. 4 with image from Yamada et al., 2021
vertebra 15 transformed to vertebra 14, abnormal Df(Chr23:hoxc13a,hoxc12a,hoxc11a,hoxc10a,hoxc9a,hoxc8a,hoxc6a,hoxc5a,hoxc4a,hoxc3a,hoxc1a)sud115/sud115 (RW) standard conditions Fig. 4 with image from Yamada et al., 2021
swim bladder morphology, abnormal Df(Chr23:hoxc13a,hoxc12a,hoxc11a,hoxc10a,hoxc9a,hoxc8a,hoxc6a,hoxc5a,hoxc4a,hoxc3a,hoxc1a)sud115/sud115 (RW) standard conditions Fig. 6 with image from Yamada et al., 2021
somite increased amount, abnormal Df(Chr23:hoxc13a,hoxc12a,hoxc11a,hoxc10a,hoxc9a,hoxc8a,hoxc6a,hoxc5a,hoxc4a,hoxc3a,hoxc1a)sud115/sud115 (RW) standard conditions Fig. 5 with image from Yamada et al., 2021
os suspensorium absent, abnormal Df(Chr23:hoxc13a,hoxc12a,hoxc11a,hoxc10a,hoxc9a,hoxc8a,hoxc6a,hoxc5a,hoxc4a,hoxc3a,hoxc1a)sud115/sud115 (RW) standard conditions Fig. 4 with image from Yamada et al., 2021
whole organism semi-viable, abnormal Df(Chr23:hoxc13a,hoxc12a,hoxc11a,hoxc10a,hoxc9a,hoxc8a,hoxc6a,hoxc5a,hoxc4a,hoxc3a,hoxc1a)sud115/sud115 (RW) standard conditions Table 1 from Yamada et al., 2021
vertebra increased amount, abnormal Df(Chr23:hoxc13a,hoxc12a,hoxc11a,hoxc10a,hoxc9a,hoxc8a,hoxc6a,hoxc5a,hoxc4a,hoxc3a,hoxc1a)sud115/sud115 (RW) standard conditions Fig. 5 with image from Yamada et al., 2021
somite border increased amount, abnormal Df(Chr23:hoxc13a,hoxc12a,hoxc11a,hoxc10a,hoxc9a,hoxc8a,hoxc6a,hoxc5a,hoxc4a,hoxc3a,hoxc1a)sud115/sud115 (RW) standard conditions Fig. 5 with image from Yamada et al., 2021
vertebra increased amount, abnormal hoxc13asud133b/sud133b; hoxc13bsud134b/sud134b standard conditions Fig. 2 with image from Adachi et al., 2024
tripus anterior region decreased length, abnormal hoxc11bsud124b/sud124b; hoxc12bsud124c/sud124c; hoxc13bsud124d/sud124d; hoxc6bsud124a/sud124a (RW) standard conditions Fig. 4 with image from Yamada et al., 2021
anal fin lepidotrichium increased amount, exacerbated hoxc12asud133a/sud133a; hoxc12bsud134a/sud134a; hoxc13asud133b/sud133b; hoxc13bsud134b/sud134b standard conditions Fig. 2 with image from Adachi et al., 2024
vertebra increased amount, abnormal hoxc12asud133a/sud133a; hoxc12bsud134a/sud134a; hoxc13asud133b/sud133b; hoxc13bsud134b/sud134b standard conditions Fig. 2 with image from Adachi et al., 2024
ventral fin fold posterior orientation, abnormal hoxc12asud133a/sud133a; hoxc12bsud134a/sud134a; hoxc13asud133b/sud133b; hoxc13bsud134b/sud134b standard conditions Fig. 2 with image from Adachi et al., 2024
anal fin radial increased amount, exacerbated hoxc12asud133a/sud133a; hoxc12bsud134a/sud134a; hoxc13asud133b/sud133b; hoxc13bsud134b/sud134b standard conditions Fig. 2 with image from Adachi et al., 2024
vertebra increased amount, abnormal hoxc12asud133a/sud133a; hoxc11asud141/sud141; hoxc11bsud128/sud128; hoxc12bsud134a/sud134a; hoxc13asud133b/sud133b; hoxc13bsud134b/sud134b standard conditions Fig. 3 with image from Adachi et al., 2024
dorsal fin lepidotrichium increased amount, exacerbated hoxc12asud133a/sud133a; hoxc11asud141/sud141; hoxc11bsud128/sud128; hoxc12bsud134a/sud134a; hoxc13asud133b/sud133b; hoxc13bsud134b/sud134b standard conditions Fig. 3 with image from Adachi et al., 2024
anal fin radial increased amount, abnormal hoxc6bsud124a/+; Df(Chr23:hoxc13a,hoxc12a,hoxc11a,hoxc10a,hoxc9a,hoxc8a,hoxc6a,hoxc5a,hoxc4a,hoxc3a,hoxc1a)sud115/sud115 standard conditions Fig. 1 with image from Adachi et al., 2024
abdominal musculature posterior region increased amount, abnormal hoxc6bsud124a/+; Df(Chr23:hoxc13a,hoxc12a,hoxc11a,hoxc10a,hoxc9a,hoxc8a,hoxc6a,hoxc5a,hoxc4a,hoxc3a,hoxc1a)sud115/sud115 standard conditions Fig. 1 with image from Adachi et al., 2024
whole organism posterior region increased height, abnormal hoxc6bsud124a/+; Df(Chr23:hoxc13a,hoxc12a,hoxc11a,hoxc10a,hoxc9a,hoxc8a,hoxc6a,hoxc5a,hoxc4a,hoxc3a,hoxc1a)sud115/sud115 standard conditions Fig. 1 with image from Adachi et al., 2024
anal fin lepidotrichium increased amount, abnormal hoxc6bsud124a/+; Df(Chr23:hoxc13a,hoxc12a,hoxc11a,hoxc10a,hoxc9a,hoxc8a,hoxc6a,hoxc5a,hoxc4a,hoxc3a,hoxc1a)sud115/sud115 standard conditions Fig. 1 with image from Adachi et al., 2024
Citations