CRISPR

CRISPR1-park7

ID
ZDB-CRISPR-200429-13
Name
CRISPR1-park7
Previous Names
None
Target
Sequence
5' - GGTGGATGTGATGCGCAGAG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The PAM site was CGG at the 3' end.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
ub2000 park7
Expression
Gene expression in Wild Types + CRISPR1-park7
No data available
Phenotype
Phenotype resulting from CRISPR1-park7
No data available
Phenotype of all Fish created by or utilizing CRISPR1-park7
Phenotype Fish Conditions Figures
caudal fin response to mechanical stimulus decreased occurrence, abnormal park7ub2000/ub2000 standard conditions Fig. 2 with image from Solheim et al., 2026
brain Ab3-park7 labeling absent, abnormal park7ub2000/ub2000 standard conditions Figure 1 with image from Gharbi et al., 2021
retinal pigmented epithelium composition, abnormal park7ub2000/ub2000 standard conditions Figure 3 with image,  Figure 4 with image from Gharbi et al., 2021
whole organism decreased weight, abnormal park7ub2000/ub2000 standard conditions Fig. 2 from Edson et al., 2019
whole organism park7 expression absent, abnormal park7ub2000/ub2000 standard conditions Fig. 1 with image from Solheim et al., 2026
Fig. 1 from Edson et al., 2019
brain park7 expression absent, abnormal park7ub2000/ub2000 standard conditions Fig. 4 from Edson et al., 2019
retinal ganglion cell decreased amount, abnormal park7ub2000/ub2000 standard conditions Figure 2 with image from Gharbi et al., 2021
caudal tuberculum dopaminergic neuron decreased amount, abnormal park7ub2000/ub2000 standard conditions Fig. 4 with image from Solheim et al., 2026
head response to mechanical stimulus decreased occurrence, exacerbated park7ub2000/ub2000 chemical treatment by environment: N-methyl-4-phenylpyridinium Fig. 2 with image from Solheim et al., 2026
retinal pigmented epithelium phagocytic vesicle increased amount, abnormal park7ub2000/ub2000 standard conditions Figure 4 with image from Gharbi et al., 2021
brain AB1-abce1 labeling increased amount, abnormal park7ub2000/ub2000 standard conditions Fig. 4 from Edson et al., 2019
caudal tuberculum dopaminergic neuron decreased amount, abnormal park7ub2000/ub2000 chemical treatment by environment: N-methyl-4-phenylpyridinium Fig. 4 with image from Solheim et al., 2026
brain AB1-gsta labeling increased amount, abnormal park7ub2000/ub2000 standard conditions Fig. 4 from Edson et al., 2019
retinal photoreceptor layer organization quality, abnormal park7ub2000/ub2000 standard conditions Figure 2 with image from Gharbi et al., 2021
swimming behavior decreased occurrence, abnormal park7ub2000/ub2000 standard conditions Fig. 3 with image from Solheim et al., 2026
NADH dehydrogenase (ubiquinone) activity decreased efficacy, abnormal park7ub2000/ub2000 standard conditions Fig. 2 from Edson et al., 2019
retina decreased thickness, abnormal park7ub2000/ub2000 standard conditions Figure 2 with image from Gharbi et al., 2021
Muller cell Ab19-gfp labeling absent, abnormal park7ub2000/ub2000 standard conditions Figure 1 with image from Gharbi et al., 2021
swimming behavior decreased occurrence, abnormal park7ub2000/ub2000 chemical treatment by environment: N-methyl-4-phenylpyridinium Fig. 3 with image from Solheim et al., 2026
retinal pigmented epithelium vacuole increased amount, abnormal park7ub2000/ub2000 standard conditions Figure 2 with image,  Figure 3 with image,  Figure 4 with image from Gharbi et al., 2021
caudal fin response to mechanical stimulus decreased occurrence, exacerbated park7ub2000/ub2000 chemical treatment by environment: N-methyl-4-phenylpyridinium Fig. 2 with image from Solheim et al., 2026
head response to mechanical stimulus decreased occurrence, abnormal park7ub2000/ub2000 standard conditions Fig. 2 with image from Solheim et al., 2026
sleep delayed, abnormal park7ub2000/ub2000 standard conditions Fig. 3 with image from Solheim et al., 2026
brain ab1-th labeling decreased amount, abnormal park7ub2000/ub2000 standard conditions Fig. 2 from Edson et al., 2019
slow muscle cell mitochondrion morphology, abnormal park7ub2000/ub2000 (AB/TU) standard conditions Figure 2 with image from Rostad et al., 2024
slow muscle cell mitochondrion degenerate, abnormal park7ub2000/ub2000 (AB/TU) standard conditions Figure 2 with image from Rostad et al., 2024
male organism slow muscle cell decreased amount, abnormal park7ub2000/ub2000 (AB/TU) standard conditions Figure 1 with image from Rostad et al., 2024
male organism fast muscle cell decreased amount, abnormal park7ub2000/ub2000 (AB/TU) standard conditions Figure 1 with image from Rostad et al., 2024
slow muscle cell autophagy increased process quality, abnormal park7ub2000/ub2000 (AB/TU) standard conditions Figure 2 with image from Rostad et al., 2024
slow muscle cell increased distance slow muscle cell, abnormal park7ub2000/ub2000 (AB/TU) standard conditions Figure 1 with image from Rostad et al., 2024
muscle NAD+ biosynthetic process decreased process quality, abnormal park7ub2000/ub2000 (AB/TU) standard conditions Figure 5 with image from Rostad et al., 2024
male organism skeletal muscle cell atrophied, abnormal park7ub2000/ub2000 (AB/TU) standard conditions Figure 1 with image from Rostad et al., 2024
brain Ab3-park7 labeling amount, ameliorated park7ub2000/ub2000; ub1001Tg standard conditions Figure 1 with image from Gharbi et al., 2021
retinal pigmented epithelium vacuole amount, ameliorated park7ub2000/ub2000; ub1001Tg standard conditions Figure 2 with image,  Figure 3 with image from Gharbi et al., 2021
retinal photoreceptor layer organization quality, ameliorated park7ub2000/ub2000; ub1001Tg standard conditions Figure 2 with image from Gharbi et al., 2021
retinal pigmented epithelium composition, ameliorated park7ub2000/ub2000; ub1001Tg standard conditions Figure 3 with image from Gharbi et al., 2021
retinal ganglion cell amount, ameliorated park7ub2000/ub2000; ub1001Tg standard conditions Figure 2 with image from Gharbi et al., 2021
retina thickness, ameliorated park7ub2000/ub2000; ub1001Tg standard conditions Figure 2 with image from Gharbi et al., 2021
brain Ab3-park7 labeling amount, ameliorated park7ub2000/ub2000; ub2003Tg standard conditions Figure 1 with image from Gharbi et al., 2021
retinal photoreceptor layer organization quality, ameliorated park7ub2000/ub2000; ub2003Tg standard conditions Figure 2 with image from Gharbi et al., 2021
retinal pigmented epithelium composition, ameliorated park7ub2000/ub2000; ub2003Tg standard conditions Figure 3 with image from Gharbi et al., 2021
retinal ganglion cell decreased amount, abnormal park7ub2000/ub2000; ub2003Tg standard conditions Figure 2 with image from Gharbi et al., 2021
retinal pigmented epithelium vacuole increased amount, abnormal park7ub2000/ub2000; ub2003Tg standard conditions Figure 2 with image,  Figure 3 with image from Gharbi et al., 2021
retina thickness, ameliorated park7ub2000/ub2000; ub2003Tg standard conditions Figure 2 with image from Gharbi et al., 2021
Citations