CRISPR

CRISPR1-fgf24

ID
ZDB-CRISPR-171204-1
Name
CRISPR1-fgf24
Previous Names
None
Target
Sequence
5' - GGCAAGAAGATTAACGCCAA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
uc47 fgf24
Expression
Gene expression in Wild Types + CRISPR1-fgf24
No data available
Phenotype
Phenotype resulting from CRISPR1-fgf24
No data available
Phenotype of all Fish created by or utilizing CRISPR1-fgf24
Phenotype Fish Conditions Figures
gonad primordium somatic cell ab2-mapk labeling absent, abnormal fgf24uc47/uc47 standard conditions Fig. 4 with image from Leerberg et al., 2017
female organism absent, abnormal fgf24uc47/uc47 standard conditions Table S2text only from Leerberg et al., 2017
gonad primordium ab1-lama1 labeling absent, abnormal fgf24uc47/uc47 standard conditions Fig. 7 with image from Leerberg et al., 2017
immature gonad germ line cell ddx4 expression decreased amount, abnormal fgf24uc47/uc47 standard conditions Fig. 2 with image from Leerberg et al., 2017
gonad primordium somatic cell amh expression decreased amount, abnormal fgf24uc47/uc47 standard conditions Fig. 5 with image from Leerberg et al., 2017
whole organism lacks all parts of type pectoral fin, abnormal fgf24uc47/uc47 standard conditions text only from Leerberg et al., 2017
gonad primordium somatic cell nr5a1a expression decreased amount, abnormal fgf24uc47/uc47 standard conditions Fig. 5 with image from Leerberg et al., 2017
gonad primordium somatic cell gata4 expression decreased amount, abnormal fgf24uc47/uc47 standard conditions Fig. 5 with image from Leerberg et al., 2017
gonad primordium somatic cell etv4 expression decreased amount, abnormal fgf24uc47/uc47 standard conditions Fig. 4 with image from Leerberg et al., 2017
gonad primordium germ line cell ddx4 expression decreased amount, abnormal fgf24uc47/uc47 standard conditions Fig. 2 with image from Leerberg et al., 2017
gonad primordium germ line cell ab1-ctnnb labeling decreased amount, abnormal fgf24uc47/uc47 standard conditions Fig. 8 with image from Leerberg et al., 2017
gonad primordium somatic cell ab1-ctnnb labeling decreased amount, abnormal fgf24uc47/uc47 standard conditions Fig. 8 with image from Leerberg et al., 2017
gonad primordium somatic cell morphology, abnormal fgf24uc47/uc47 standard conditions Fig. 7 with image from Leerberg et al., 2017
gonad primordium somatic cell cyp19a1a expression decreased amount, abnormal fgf24uc47/uc47 standard conditions Fig. 5 with image from Leerberg et al., 2017
gonad disorganized, abnormal fgf24uc47/uc47 ; uc46Tg ; uc02Tg standard conditions Fig. 2 with image from Leerberg et al., 2017
gonad germ line cell EGFP expression decreased amount, abnormal fgf24uc47/uc47 ; uc46Tg ; uc02Tg standard conditions Fig. 2 with image from Leerberg et al., 2017
germ line cell decreased amount, abnormal fgf24uc47/uc47 ; uc46Tg ; uc02Tg standard conditions Fig. 2 with image from Leerberg et al., 2017
Sertoli cell absent, abnormal fgf24uc47/uc47 ; uc46Tg ; uc02Tg standard conditions Fig. 2 with image from Leerberg et al., 2017
Sertoli cell mCherry expression absent, abnormal fgf24uc47/uc47 ; uc46Tg ; uc02Tg standard conditions Fig. 2 with image from Leerberg et al., 2017
gonad primordium cell population proliferation decreased process quality, abnormal uc02Tg ; fgf24uc47/uc47 control Fig. 6 with image from Leerberg et al., 2017
female organism absent, abnormal fgf24uc47/uc47 ; tp53zdf1/zdf1 standard conditions Table S2 from Leerberg et al., 2017
Citations