ZFIN ID: ZDB-GENE-980526-442

Mapping Details

Gene Name: growth differentiation factor 6b
Symbol: gdf6b
PHYSICAL MAP AND BROWSER
Genome Browser Chr Position Assembly
ZFIN Gbrowse 19 22,999,181 - 23,002,883 GRCz11
Ensembl 19 22,999,181 - 23,002,883 GRCz11
Vega 19 23,414,858 - 23,418,560 GRCv10
NCBI Map Viewer 19 22,999,269 - 23,002,708 GRCz11
UCSC 19 - GRCv10
Mapped Clones containing gdf6b
DKEY-158E13 Chr: 19 Details
CH211-244A23 Chr: 19 Details
PHYSICAL MAPPING
Feature Chr Position Assembly Citations
sa23521 19 23,001,848 GRCz11 Busch-Nentwich et al., 2013
19 23,417,525 GRCz10 Busch-Nentwich et al., 2013
19 23,488,110 Zv9 Busch-Nentwich et al., 2013
sa36836 19 23,001,828 GRCz11 Busch-Nentwich et al., 2013
19 23,417,505 GRCz10 Busch-Nentwich et al., 2013
19 23,488,090 Zv9 Busch-Nentwich et al., 2013
sa43280 19 23,001,818 GRCz11 Busch-Nentwich et al., 2013
19 23,417,495 GRCz10 Busch-Nentwich et al., 2013
19 23,488,080 Zv9 Busch-Nentwich et al., 2013
zf3339 19 22,999,561 - 22,999,568 GRCz11 Gramann et al., 2019

GENETIC MAPPING PANELS
Chr Location Mapped As Panel Mapped By Scoring
19 94.3 cM dynamo Mother of Pearl (MOP) Postlethwait, John H. Data
19 66.6 cM gdf6b Heat Shock (HS) Woods, Ian G. Data
19 40.42 cM dynamo Gates et al (GAT) Talbot, William S. Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location.
Physical map location should be used whenever possible.
MAPPING FROM PUBLICATIONS
Marker Type Chr Distance Publication / Person Comments
mc5ra GENE 19 0.0 cM Ringholm et al., 2002 Ringholm et al. (2002, J Neurochem 82(1):6-18) report mapping mc5ra to LG 19, 12.3 cM from hoxa11a, indistinguishably close to gdf6b, using the Heat Shock mapping panel.
hoxa11a GENE 19 Ringholm et al., 2002 Ringholm et al. (2002, J Neurochem 82(1):6-18) report mapping mc5ra to LG 19, 12.3 cM from hoxa11a, indistinguishably close to gdf6b, using the Heat Shock mapping panel.

OTHER MAPPING INFORMATION
Markers Encoded by gdf6b
fc13c07 Chr: 19 Details
Primer Sets:
Strain Bandsize Restriction Enzyme Annealing Temperature [C]
SJD 204 36.0
Forward Primer TGTTTTTATCCAAGCAGTTCTCAC
Reverse Primer CATTCTTGCCGTATTTTGCTCTCC