ZFIN ID: ZDB-GENE-980526-474

Mapping Details

Gene Name: bone morphogenetic protein 2b
Symbol: bmp2b
PHYSICAL MAP AND BROWSER
Genome Browser Chr Position
Vega 20 45,989,453 - 45,995,429
NCBI Map Viewer 20 39,751 - 45,748
Mapped Clones containing bmp2b
CH211-213I16 Chr: 20 Details
PHYSICAL MAPPING
Feature Chr Position Assembly Citations
sa18243 20 45,896,039 GRCz11 Busch-Nentwich et al., 2013
20 45,992,319 GRCz10 Busch-Nentwich et al., 2013
20 46,429,654 Zv9 Busch-Nentwich et al., 2013

GENETIC MAPPING PANELS
Chr Location Mapped As Panel Mapped By Scoring
20 176.7cM bmp2 Mother of Pearl (MOP) Postlethwait, John H. Data
20 720.06cR bmp2b Loeb/NIH/5000/4000 (LN54) Dawid, Igor B. Data
20 3812.0cR bmp2b Goodfellow T51 (T51) Geisler, Robert Data
20 116.8cM bmp2b Heat Shock (HS) Woods, Ian G. Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location.
Physical map location should be used whenever possible.
MAPPING FROM PUBLICATIONS
Marker Type Chr Distance Publication / Person Comments
z13626 SSLP 20 Kikuchi et al., 2000 Kikuchi et al. (2000.Genes Dev. 14:1279-1289) report mapping bon to LG20,  ...
z20046 SSLP 20 Kikuchi et al., 2000 Kikuchi et al. (2000.Genes Dev. 14:1279-1289) report mapping bon to LG20,  ...
mixl1 GENE 20 3.9cM Kikuchi et al., 2000 Kikuchi et al. (2000.Genes Dev. 14:1279-1289) report mapping bon to LG20,  ...
14p1500 RAPD 20 14.81cM Lee et al., 1998 Lee et al. (1998. Dev. Genet. 23(2):97-103) mapped bmp2b to linkage  ...
9ae.550 RAPD 20 Lee et al., 1998 Lee et al. (1998. Dev. Genet. 23(2):97-103) mapped bmp2b to linkage  ...
12f580 RAPD 20 Lee et al., 1998 Lee et al. (1998. Dev. Genet. 23(2):97-103) mapped bmp2b to linkage  ...

OTHER MAPPING INFORMATION
Genomic Feature ta72a is an allele of bmp2b
Marker Type Chr Distance Publication / Person Comments
z536 SSLP 20 12.5cM Mullins, 1999
Primer Sets:
Strain Bandsize Restriction Enzyme Annealing Temperature [C]
SJD 160 36.0
Forward Primer GCTCAGCCCTATCTCACTGC
Reverse Primer TTTCTTCCTCCAAAATAGCTCG
Genomic Feature tc300a is an allele of bmp2b