ZFIN ID: ZDB-ALT-980203-1108
Genomic Feature: tm98
Synonyms: M098B (1), M98B (1)
Affected Genomic Regions: dlc
Type: Point Mutation (1)
Protocol: adult males treated with ENU
Lab Of Origin: Nüsslein-Volhard Lab
Location: Chr 15: 20465637 (GRCz11) (1) Details
Sequence:
Current Sources: European Zebrafish Resource Center (EZRC)    (order this)
MUTATION DETAILS No data available
FLANKING SEQUENCE (GENOMIC)
CACCATCTTCTGCTTATAGTTTGATTTGTCACTGGAATGTGTGTCTACAGAGGTGGATCTGAGCGCCATATCTTTATTGGACACCTTAAATGGGCCACCAGGAATAAGGAAGGCCTCCTTCTCTCTACCTAAAGTGGAGGTTGGGCTCAAAGAAATGCGATTATTGACAGAATCCAGGTTGTTTCGAACTGTGGTTGAGCTGGCTTTGTGGTTCTGACGCATCTGTCGCAGGACCACAATGGCAGCACAGATCACTAAGGTTAGAGTAATGAGGCCTAGAGTAAATGAGACTATTAAGGCTGCTGGAAGAGCAGGGCTGTTCACAGGCGTGGGCTTCTGTTTGTACTCGCACTGTGTGCCCATGAAGCCTGCCGGGCACTGGCAGACAGGCCCAGAGAAGTGAGTGTAGCAGGTTCCTCCGTTCTGGCAGGGCATGAAACTGCAGGCGTCAGAGCGAACCCTACAGTCCTTGCCTGAGAAACCAAGCGTGCATGTGCAGG
T/G
GTACCCGTTGATACCATCCACGCAGGTGCCTGCATTTTGACAGGGGTTGCTTGAGCAGTCGTCAATGTTTGTTTCACAACGTGAGCCTGTGAACCCGGGCCGGCAACGGCACGTCGCTTTGTTGCCCAAATCGAGACACTGGCCACCTTTAAAAAAAATGCAGGGTGTTAACGTAATAAGCCTAAAATTTTGGAAAGTGAAATTGAATAATTAGGACAAAGGAGTACACCAGGGCAAGCAACCCTTGGGAAAGCAATGGTGCATGTTTTAGACTAATAAAGGTCTATTGCTTTATGACAGCTCTATCTCACCATATCAGTGTAAGAGTCTCACTGGCGTCTGTTCTATCATGCATGAGTAGTATGTCACGCACAGTTGACGAATCCCAAAACAAAAAAAGCTGAAGGATCAGCATGTTTCAAGAGGTGTAGATGGCTGGAATGAATTGCATTTAGGACTGAAAATAAGTGCAAAATATTCTCACCGTTAGCACAGGGGTC
OTHER tm98 PAGES No links to external sites
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous dlctm98/tm98 dlc ♀+/- ♂+/-
dlctm98/tm98 dlc Unknown
Complex dlctm98/tm98; her1hu2124/hu2124 dlc, her1

CITATIONS  (25)