Transcript

elovl5-203

ID
ZDB-TSCRIPT-141209-685
Name
elovl5-203
Previous Names
  • elovl5-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000060505 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000060505|OTTDARG00000020641|ZDB-GENE-040407-2 elovl5|OTTDARP00000046758 elovl5-002 LG_ CR376766.8 Danio rerio protein_coding KNOWN, 539 bp
CTTGCGTTCTGTTGAGGAGGAATCGATACATTCGCGTTCT
AAATCAACTTCAAACATGAGTACAGTTGCATGACGTCATC
ATAAATGTCAACAAACTGCTACATCATTAAAAGTTTGTTG
CATCTCCTCAGCGCCTCCTGGTAAAAATCGAATGAGGTTG
AAGATGGAGACGTTTAGTCACAGAGTCAACTCTTATATTG
ACTCCTGGATGGGACCCAGAGATCTCAGGGTCACAGGATG
GTTTCTGCTGGACGACTACATTCCCACCTTTATCTTCACT
GTCATGTACCTGCTGATTGTGTGGATGGGACCGAAATACA
TGAAGAACAGACAGGCGTACTCTTGCAGAGCCCTGCTGGT
GCCGTATAACCTGTGTCTGACGCTGCTGTCTCTCTATATG
TTCTATGAGCTGGTCATGTCTGTGTATCAAGGTGGGTACA
ACTTCTTCTGCCAGAACACCCACAGTGGAGGAGACGCCGA
CAACAGGATGATGAATGTCCTGTGGTGGTATTACTTCTCC
AAGCTCATCGAGTTCATGG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations