Transcript

elovl5-004

ID
ZDB-TSCRIPT-141209-3129
Name
elovl5-004
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000060507 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000060507|OTTDARG00000020641|ZDB-GENE-040407-2 elovl5|no_translation elovl5-004 LG_ CR376766.8 Danio rerio protein_coding KNOWN, 677 bp
GCCCTGAGCAACACACACTCGCACACTTCTAAAGACTAAA
GGTTGAAGATGGAGACGTTTAGTCACAGAGTCAACTCTTA
TATTGACTCCTGGATGGGACCCAGAGATCTCAGGGTCACA
GGATGGTTTCTGCTGGACGACTACATTCCCACCTTTATCT
TCACTGTCATGTACCTGCTGATTGTGTGGATGGGACCGAA
ATACATGAAGAACAGACAGGCGTACTCTTGCAGAGCCCTG
CTGGTGCCGTATAACCTGTGTCTGACGCTGCTGTCTCTCT
ATATGTTCTATGAGCTGGTCATGTCTGTGTATCAAGGTGG
GTACAACTTCTTCTGCCAGAACACCCACAGTGGAGGAGAC
GCCGACAACAGGGTAAAACAACAAACTGAGTTTTCCACTG
AATGAGACTTGAACATTCTAAGTCTCAGCTTAACCCTTTT
ATCACAATCCCCGGAAAAGACACAATATTCCCTGCTGGGC
TCTTACATAAGTGTCCTGTTGACCCGGCTGCTCTGACACG
AGTATTCAGAGGACACATAACACAGCAGAGGTTGCCTTAG
ACTTCTAATATTGCATTTTTGTAATATACGTGATGAAATG
ATTTCTTGCATGTGCTTATGCTGTCCTCAGATGATGAATG
TCCTGTGGTGGTATTACTTCTCCAAGCTCATCGAGTT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations