Transcript

elovl5-201

ID
ZDB-TSCRIPT-090929-8598
Name
elovl5-201
Previous Names
  • elovl5-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000025894 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000025894|OTTDARG00000020641|ZDB-GENE-040407-2 elovl5|OTTDARP00000021275 elovl5-001 LG_ CR376766.8 Danio rerio protein_coding KNOWN, 2206 bp
AGATGAAGGTGGACTACACACACTCATGACGCTCATTAGT
TCAGCAGCTTCACACTCAAACACACACATCCTCCAAGGAC
AGGACGAAGCCCTGAGCAACACACACTCGCACACTTCTAA
AGACTAAAGGTTGAAGATGGAGACGTTTAGTCACAGAGTC
AACTCTTATATTGACTCCTGGATGGGACCCAGAGATCTCA
GGGTCACAGGATGGTTTCTGCTGGACGACTACATTCCCAC
CTTTATCTTCACTGTCATGTACCTGCTGATTGTGTGGATG
GGACCGAAATACATGAAGAACAGACAGGCGTACTCTTGCA
GAGCCCTGCTGGTGCCGTATAACCTGTGTCTGACGCTGCT
GTCTCTCTATATGTTCTATGAGCTGGTCATGTCTGTGTAT
CAAGGTGGGTACAACTTCTTCTGCCAGAACACCCACAGTG
GAGGAGACGCCGACAACAGGATGATGAATGTCCTGTGGTG
GTATTACTTCTCCAAGCTCATCGAGTTCATGGACACCTTC
TTCTTCATCCTGAGGAAAAACAACCACCAGATCACGTTCC
TGCACGTGTATCATCACGCCACCATGCTCAACATCTGGTG
GTTCGTCATGAACTGGGTGCCGTGTGGACACTCGTATTTT
GGTGCAACCTTTAACAGCTTCATCCATGTGCTGATGTACT
CGTATTACGGCCTGTCTGCGGTTCCAGCTTTGCGGCCGTA
TCTGTGGTGGAAGAAGTACATCACTCAAGGACAGCTGGTC
CAGTTTGTCCTGACCATGTTCCAGACGTCTTGTGCTGTGG
TTTGGCCGTGTGGTTTCCCAATGGGCTGGCTGTATTTCCA
AATCTCTTACATGGTCACGCTCATCCTGCTCTTCTCAAAC
TTCTACATTCAGACCTATAAGAAACGTTCGGGATCCAGGA
AAAGCGATTACCCCAATGGATCAGTAAACGGCCACACTAA
TGGAGTGATGTCCAGCGAGAAGATTAAACACAGAAAAGCA
CGAGCAGATTGATGGCAGTTCATCCATTATTGATACGCAC
ACATTAGATCCATGTCCACTGACCACGCTAAAAACATTTC
ATATTTCCGAGAGAGAGAGACTCCTTACACGTTTGCACAC
TGCAACCTCATTTTATTCATATTGAATCCAAAACAAAGTG
CATAAGAGAGCTACGATTAGAGTCCAGGTTAGCTTACATC
TAGAATGCAGAGTTGAAGCCAAAATGATTCGCCCTCCTGT
GAATTTTATTTCCTTTTTCAAATGTTTCTCAAACGATGTT
GAACAGATTCAGGAATTTTTTTACAGTATTTCCTATAATA
TTTGTTCTTCTGGAGAAAGTCTTATTTGTTTTATTTCGGC
TAGAAGGAAAGCAGTTTTTAATTATTTTAAACCCATTTTA
AGGTCAATATTATTCGCCCCCTTAAGCAGTATTTGTTTTG
GATTGCCTTCAAAACAAACCACTGTTATACAATGACTTGC
CTAATTACCATAACTTTACCCTAATTCGTTTAAATGTCAC
TTTAAAGGGTCATGACACCTCCCACTTTCGGTTCGAATCT
ACTTCAGAATATTTTTCAAAAGATGCATGATAATTGGGGG
TGGAGCTCCGCAAGCAAAGGACAGGAATGGGCGTGGCCAG
CAGAGCAGGGGAGAAGCAGGGGAGTGAAAAACTGTTGTCA
GTCGGCTCACAAAATGAGACACAAACCGTGAGGAGACGCA
TGAGTTTATAGTTTACAAAGTTAAAATGCAAAGAAATAAA
CAGTGATTTAATGCCAGGGTTCAACGCTAACGCCCCATTC
ACACGAGGCTTCAGCGTCAACGCTTGACTGAAGGCGTGTC
TGAAGTTGGGGCTGAAGCGATCGTCATAAAGTGTCAGCCA
ATGAAATTCAGTCAGCAATAGGCCACTGTCTGAGCTGGTG
TATTTGCATACAGCGATCTGATTGGCTGACGCTTCTGTTG
GCGATTGAAAAGTTGAGCTAGTCCCAACTTCTGCAGCGAG
CAACGCCTCTGAAGCGGCGCTGATGGATCCACAATGCAGT
TCGGCAACGCCTGACGTCACCCATTCAAAGTGAATGGGAA
GCGTTGACGCTGACGCCCCGTGTGAATGGGGCGTAAGGAT
TTTTTCTACTGGTCCAATCGGGCCAATGGTTCAGATTTTT
ACTTGCCCTGCCAAAATTTTCACTGGCCCCATTAAAAAAT
AAAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations