Transcript

elovl5-204

ID
ZDB-TSCRIPT-141209-1909
Name
elovl5-204
Previous Names
  • elovl5-003
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000060506 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000060506|OTTDARG00000020641|ZDB-GENE-040407-2 elovl5|OTTDARP00000046759 elovl5-003 LG_ CR376766.8 Danio rerio protein_coding KNOWN, 833 bp
AGATGAAGGTGGACTACACACACTCATGACGCTCATTAGT
TCAGCAGCTTCACACTCAAACACACACATCCTCCAAGGAC
AGGACGAAGCCCTGAGCAACACACACTCGCACACTTCTAA
AGACTAAAGGACTTTCCCTGACAGTCTGAATTCGCTCCGA
CTTGTGAAAACAGCTGAAGTAATCTTGGTGTTATTCCTCT
TGAAGGTTGAAGATGGAGACGTTTAGTCACAGAGTCAACT
CTTATATTGACTCCTGGATGGGACCCAGAGATCTCAGGGT
CACAGGATGGTTTCTGCTGGACGACTACATTCCCACCTTT
ATCTTCACTGTCATGTACCTGCTGATTGTGTGGATGGGAC
CGAAATACATGAAGAACAGACAGGCGTACTCTTGCAGAGC
CCTGCTGGTGCCGTATAACCTGTGTCTGACGCTGCTGTCT
CTCTATATGTTCTATGAGCTGGTCATGTCTGTGTATCAAG
GTGGGTACAACTTCTTCTGCCAGAACACCCACAGTGGAGG
AGACGCCGACAACAGGATGATGAATGTCCTGTGGTGGTAT
TACTTCTCCAAGCTCATCGAGTTCATGGACACCTTCTTCT
TCATCCTGAGGAAAAACAACCACCAGATCACGTTCCTGCA
CGTGTATCATCACGCCACCATGCTCAACATCTGGTGGTTC
GTCATGAACTGGGTGCCGTGTGGACACTCGTATTTTGGTG
CAACCTTTAACAGCTTCATCCATGTGCTGATGTACTCGTA
TTACGGCCTGTCTGCGGTTCCAGCTTTGCGGCCGTATCTG
TGGTGGAAGAAGTACATCACTCAAGGACAGCTG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations