Transcript

srsf3a-202

ID
ZDB-TSCRIPT-131113-4620
Name
srsf3a-202
Previous Names
  • sfrs3a-006
  • srsf3a-006
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000059480 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000059480|OTTDARG00000042352|ZDB-GENE-030616-631 srsf3a|OTTDARP00000046352 sfrs3a-006 LG_ AL732567.8 Danio rerio protein_coding KNOWN, 855 bp
TTTACATTTGCTCGCGAGAACCCGTGGTCTGTATTAGCGC
GAAAGCAACGAGGTGTTAGGTGTTCAGTTGAGATTGGAAT
TGAAGACATGGGGGATCCTTCCCTAACCCGGGACTGCCCG
CTAGACTGTAAGGTCTATGTTGGAAATTTAGGCAACAGTG
GTAATAAGACTGAACTTGAGAGAGCGTTTGGCTATTATGG
TCCACTGAGGAGCGTATGGGTGGCCAGAAATCCTCCCGGC
TTTGCTTTTGTGGAGTTTGAAGACCCAAGAGATGCAACTG
ATGCTGTGAGGGAGCTAGATGGAAGAACACTGTGCGGTTG
TCGGGTCCGAGTTGAAATGTCCAATGGTGAGAAACGTTCA
AGGTTTCGAGGGCCACCTCCTTCATGGAGTCGCCGGCCAC
GAGACGATTATAGACGTGGTGATGATTATAGACGCCGCAG
CAGCCCACCTGCAAGACACCGAGACATCACCAAGCCTCTA
CTCATCTACCTCTGAGTCAGTCAACTAGCCCTCTTTCAGC
ATCATGTGACCAGCGTACACCAATCAGCTCACATGATTCA
AGCATGGCCACCAGCCCATTGGTTCCTGAGCATGCCTCTC
TCTCAGGCTCCTTCACCTCCTCCAACGTTAACCTGATCGG
CAAAACCAACCACGCCACATTTACAACCAATCGACGGGTC
TTATGCCCCCTCCCCAAATGTCTACATGACAACATACCCT
CAGCAGTCCTCATCTAACTGACATCTTCAGCCACCTACTG
TATAGCAGTTAACATCTAGCAACCATCTGGCAAAATCTCC
CCGCAAATTTCGCCCTCCTGACCAGCACTCAGCTTCACTG
CATCATAACTAGCTT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations