Transcript

srsf3a-206

ID
ZDB-TSCRIPT-131113-1428
Name
srsf3a-206
Previous Names
  • sfrs3a-003
  • srsf3a-003
  • ottdart00000059481
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000059481 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000059481|OTTDARG00000001938|ZDB-GENE-030616-631 srsf3a|OTTDARP00000046353 zC263A23.10-002 LG_ AL732567.8 Danio rerio protein_coding KNOWN, 889 bp
ACGCGTCGTCTGTTTTTAGACTGAAGCTTGGGTACATTTA
ATACAAACGTCTGGGAAGTGGAATTAACATGGCATGCGTC
CGTGTGTTTATTCGCCCGAACGGACCTTCTCATATATGAA
AAGGCGAGAGAGCCTACGGCTGTCACATACTGTATACAGT
ACAAGTGTGACATCTCAGAACACCTTCCGGTAATCTTTCA
GGTGTTCAGTTGAGATTGGAATTGAAGACATGGGGGATCC
TTCCCTAACCCGGGACTGCCCGCTAGACTGTAAGGTCTAT
GTTGGAAATTTAGGCAACAGTGGTAATAAGACTGAACTTG
AGAGAGCGTTTGGCTATTATGGTCCACTGAGGAGCGTATG
GGTGGCCAGAAATCCTCCCGGCTTTGCTTTTGTGGAGTTT
GAAGACCCAAGAGATGCAACTGATGCTGTGAGGGAGCTAG
ATGGAAGAACACTGTGCGGTTGTCGGGTCCGAGTTGAAAT
GTCCAATGGTGAGAAACGTTCAAGGTTTCGAGGGCCACCT
CCTTCATGGAGTCGCCGGCCACGAGACGATTATAGACGTG
GTGATGATTATAGACGCCGCAGCAGCCCACCTGCAAGACA
CCGAGACATCACCAAGCCTCTACTCATCTACCTCTGAGTC
AGTCAACTAGCCCTCTTTCAGCATCATGTGACCAGCGTAC
ACCAATCAGCTCACATGATTCAAGCATGGCCACCAGCCCA
TTGGTTCCTGAGCATGCCTCTCTCTCAGGCTCCTTCACCT
CCTCCAACGTTAACCTGATCGGCAAAACCAACCACGCCAC
ATTTACAACCAATCGACGGGTCTTATGCCCCCTCCCCAAA
TGTCTACATGACAACATACCCTCAGCAGTCCTCATCTAAC
TGACATCTT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations