Transcript

srsf3a-205

ID
ZDB-TSCRIPT-131113-3028
Name
srsf3a-205
Previous Names
  • sfrs3a-004
  • srsf3a-004
  • ottdart00000059479
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000059479 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000059479|OTTDARG00000001938|ZDB-GENE-030616-631 srsf3a|OTTDARP00000046351 zC263A23.10-001 LG_ AL732567.8 Danio rerio protein_coding KNOWN, 806 bp
GTGCGGTGGAGAGGCTCTGTTGACTGACTCATCGGCGCAG
CGGAGAGCCTACGGCTGTCACATACTGTATACAGTACAAG
TGTGACATCTCAGAACACCTTCCGGTAATCTTTCAGGTGT
TCAGTTGAGATTGGAATTGAAGACATGGGGGATCCTTCCC
TAACCCGGGACTGCCCGCTAGACTGTAAGGTCTATGTTGG
AAATTTAGGCAACAGTGGTAATAAGACTGAACTTGAGAGA
GCGTTTGGCTATTATGGTCCACTGAGGAGCGTATGGGTGG
CCAGAAATCCTCCCGGCTTTGCTTTTGTGGAGTTTGAAGA
CCCAAGAGATGCAACTGATGCTGTGAGGGAGCTAGATGGA
AGAACACTGTGCGGTTGTCGGGTCCGAGTTGAAATGTCCA
ATGGTGAGAAACGTTCAAGGTTTCGAGGGCCACCTCCTTC
ATGGAGTCGCCGGCCACGAGACGATTATAGACGTGGTGAT
GATTATAGACGCCGCAGCAGCCCACCTGCAAGACACCGGT
CTCCCAGGAGGAGCTTTAGCCGTAGTCGGAGCAGGTCCCT
TTCCAGAGAGAGGAGAAGAGAGAGGTCTTTGTCTCGAGAT
AGAAACTATAAACCTTCAAGGTCTTTCTCAGGATCACGCA
GTCGTTCGCGATCCAATGGTCGGAAGTGAAGTCTTCAAGC
CCAGCATTGTCAGAAAAAGTGTGTCTGTGCCTGCTCTCTA
ACAGACTAGGATGATGGGAAACAACGATGGAGTTTTTTTT
TTTTTTTTTTTGGCCCCCCAAAAGTCTTTTAAAATGTTTT
TCCCCC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations