Transcript

srsf3a-203

ID
ZDB-TSCRIPT-090929-66
Name
srsf3a-203
Previous Names
  • sfrs3a-002
  • srsf3a-002
Transcript Type
aberrant processed transcript
Annotation Status
nonsense mediated decay
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000002070 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000002070|OTTDARG00000042352|ZDB-GENE-030616-631 srsf3a|OTTDARP00000001826 sfrs3a-002 LG_ AL732567.8 Danio rerio protein_coding KNOWN, 1104 bp
TTTATTTACATTTGCTCGCGAGAACCCGTGGTCTGTATTA
GCGCGAAAGCAACGAGGTGTTAGGTGCGTTTTCCATTTCG
CTAAAACATACAAATCATATATACCGGTGTTCAGTTGAGA
TTGGAATTGAAGACATGGGGGATCCTTCCCTAACCCGGGA
CTGCCCGCTAGACTGTAAGGTCTATGTTGGAAATTTAGGC
AACAGTGGTAATAAGACTGAACTTGAGAGAGCGTTTGGCT
ATTATGGTCCACTGAGGAGCGTATGGGTGGCCAGAAATCC
TCCCGGCTTTGCTTTTGTGGAGTTTGAAGACCCAAGAGAT
GCAACTGATGCTGTGAGGGAGCTAGATGGAAGAACACTGT
GCGGTTGTCGGGTCCGAGTTGAAATGTCCAATGGTGAGAA
ACGTTCAAGGTTTCGAGGGCCACCTCCTTCATGGAGTCGC
CGGCCACGAGACGATTATAGACGTGGTGATGATTATAGAC
GCCGCAGCAGCCCACCTGCAAGACACCGAGACATCACCAA
GCCTCTACTCATCTACCTCTGAGTCAGTCAACTAGCCCTC
TTTCAGCATCATGTGACCAGCGTACACCAATCAGCTCACA
TGATTCAAGCATGGCCACCAGCCCATTGGTTCCTGAGCAT
GCCTCTCTCTCAGGCTCCTTCACCTCCTCCAACGTTAACC
TGATCGGCAAAACCAACCACGCCACATTTACAACCAATCG
ACGGGTCTTATGCCCCCTCCCCAAATGTCTACATGACAAC
ATACCCTCAGCAGTCCTCATCTAACTGACATCTTCAGCCA
CCTACTGTATAGCAGTTAACATCTAGCAACCATCTGGCAA
AATCTCCCCGCAAATTTCGCCCTCCTGACCAGCACTCAGC
TTCACTGCATCATAACTAGCTTGTTAGTCTCCCAGGAGGA
GCTTTAGCCGTAGTCGGAGCAGGTCCCTTTCCAGAGAGAG
GAGAAGAGAGAGGTCTTTGTCTCGAGATAGAAACTATAAA
CCTTCAAGGTCTTTCTCAGGATCACGCAGTCGTTCGCGAT
CCAATGGTCGGAAGTGAAGTCTTCAAGCCCAGCATTGTCA
GAAAAAGTGTGTCTGTGCCTGCTC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations