Transcript

srsf3a-201

ID
ZDB-TSCRIPT-090929-65
Name
srsf3a-201
Previous Names
  • sfrs3a-001
  • srsf3a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000002069 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000002069|OTTDARG00000042352|ZDB-GENE-030616-631 srsf3a|OTTDARP00000001825 sfrs3a-001 LG_ AL732567.8 Danio rerio protein_coding KNOWN, 1010 bp
GGAAGTGCTTTTTATTTACATTTGCTCGCGAGAACCCGTG
GTCTGTATTAGCGCGAAAGCAACGAGGTGTTAGGTGCGTT
TTCCATTTCGCTAAAACATACAAATCATATATACCGGTGT
TCAGTTGAGATTGGAATTGAAGACATGGGGGATCCTTCCC
TAACCCGGGACTGCCCGCTAGACTGTAAGGTCTATGTTGG
AAATTTAGGCAACAGTGGTAATAAGACTGAACTTGAGAGA
GCGTTTGGCTATTATGGTCCACTGAGGAGCGTATGGGTGG
CCAGAAATCCTCCCGGCTTTGCTTTTGTGGAGTTTGAAGA
CCCAAGAGATGCAACTGATGCTGTGAGGGAGCTAGATGGA
AGAACACTGTGCGGTTGTCGGGTCCGAGTTGAAATGTCCA
ATGGTGAGAAACGTTCAAGGTTTCGAGGGCCACCTCCTTC
ATGGAGTCGCCGGCCACGAGACGATTATAGACGTGGTGAT
GATTATAGACGCCGCAGCAGCCCACCTGCAAGACACCGGT
CTCCCAGGAGGAGCTTTAGCCGTAGTCGGAGCAGGTCCCT
TTCCAGAGAGAGGAGAAGAGAGAGGTCTTTGTCTCGAGAT
AGAAACTATAAACCTTCAAGGTCTTTCTCAGGATCACGCA
GTCGTTCGCGATCCAATGGTCGGAAGTGAAGTCTTCAAGC
CCAGCATTGTCAGAAAAAGTGTGTCTGTGCCTGCTCTCTA
ACAGACTAGGATGATGGGAAACAACGATGGAGTTTTTTTT
TTTTTTTTTTTGGCCCCCCAAAAGTCTTTTAAAATGTTTT
TCCCCCCCATAGTGTTCTAAGTATCTTTTTTTTACTTAAG
ATATCTGTGCTTAATGGGTAGTAATGGTTTCATCCTGCCT
CAATGCTTGGAATGTAATTTTATGCTCTTTGGGCAGAGAA
GTGTTCTGAATGGTCTGATCTAGGGGATCATTTGAAGACG
ATTTTGTATGCTTTTTTTGTTTGTACTTCCATTAAAATGT
TCCTTACGAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations