Transcript

cad-003

ID
ZDB-TSCRIPT-130528-161
Name
cad-003
Previous Names
None
Transcript Type
ncRNA
Annotation Status
Withdrawn by Sanger
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000058666 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000058666|OTTDARG00000006087|ZDB-GENE-021030-4 cad|no_translation cad-003 LG_ BX511178.6 Danio rerio protein_coding KNOWN, 6938 bp
GCCTTTTTCTACACCAGGGACAGCATGCTATTTGGCCTAG
ATAACAACAACAACATCTAAAAGGCGCATTTATTTACTCC
GCATCCGGGTGAACATCACCTTGCGCGGCGTGCTTTTCAC
GTGGGCAAACTTCGGCGATAAGGGAGAAACAGAAGTCATT
CAGTTCAACTCGATTATACTTTTTGTTAACGCTAGATATT
CGCTTAGTGTTTAGAAATACGAACAGTTTAGTCATGTCGC
TGAAAATGGCATCTTTAGTGCTGGAGGACGGGACGACATT
TAAAGGCCGTCTGTTCGGTGCCGTATCTTCAGTGTCTGGT
GAAGTTGTTTTCCAGACAGGAATGGTGGGTTATCCGGAGG
CACTCACAGATCCGTCTTACAAGTCCCAAATACTAACTCT
GACGTACCCGATGATTGGCAATTATGGTATTCCAAAAGAT
GAAGATGGAGAGTTTGGACTCAGCAAGTGGTTTGAATCTT
CCCAAATCCATGCTGCTGCTCTCATTGTTGGGGAGGTTTC
GGAGAATCCCAGTCACTGGAGCGCCGCCAAATCTCTGGAT
GAGTGGCTCAGAGAGCAAGGCATCCCTGGCCTCCAAGGTG
TTGACACTCGATGCTTGACCAAAAAGATCAGAGAGAAGGG
AACCATGTTGGGAAAACTTGTGGTGGAAGGAACTCCAGCC
GACAATATTCCGTTTGACAATCCAGATGCCCGAAACCTTG
TTAAAGAAGTTTCCATGAAAGCACCAAAAGTGTTTAATCC
AGAGGGCACAGTGAGAATCACTGCTATAGACTGTGGCATC
AAGTACAACCAGATACGTTGCTTGTGCCAGAGAGGCGCCC
GGGTCACTGTTGTCCCCTGGGATCAACCTCTGGACAGCAA
TGACTTTGATGGGTTGTTTATCAGCAACGGTCCTGGCAAT
CCTGAGTACTGTAAGGAGACTGTAGAGAATATACGCAAAG
TGGCATGTGTGGAGAATCCCAAACCTATCTTTGGAATTTG
CTTGGGCCATCAGCTGCTGTCTTTGGTCATTGGCGCAAAG
ACATACAAAATGAAGTACGGTAATCGTGGCCATAATCAGC
CATGCATCCATAAAGGAACCAGTCGCTGTTACATCACCTC
TCAGAATCACGGGTTTGCTGTGGATCCAGAAACTCTTCCA
AAGGACTGGGATGTGCTCTTCACCAATGCTAATGACCAAA
CCAGCGAGGGCATCGTTCATAATCACAAACCACTCTTCAG
TGTCCAGTTCCATCCTGAACACATGGCAGGTCCCACAGAC
CTTGTTGGTCTCTTTGATGTGTTTCTGGATACAGTCAGAG
ATGTAAAGGAGAACAAGGCTGGAAAATCAGGTGATCTGAC
AGTGAAGCAAAGATTAATGGAGCACCTCACCTTTCCTGGA
TCTCCTGACCCAAATGCCTTTGTTCGACCACGTAAAGTTC
TGGTTCTGGGTTCAGGTGGTCTTTCCATTGGACAGGCTGG
AGAGTTTGACTATTCTGGATCTCAGGCTATAAAAGCTATG
AAAGAAGAGAATATCCAAACCATTCTCATCAACCCAAACA
TTGCCACAGTACAAACCTCAAAGGGCCTGGCAGACAAAGT
CTACTTCCTTCCGATCACACCAGAGTACGTCACACAGGTG
ATAAAGAACGAGCGTCCAGATGGGGTGTTGCTCACTTTCG
GAGGTCAGACAGCCCTGAACTGTGGTGTGGAACTCAAAAA
ACAAGGAGTGCTGGAAAAATACAAAGTGCGTGTGCTTGGT
ACCCCAGTGGCCTCCATAGAGATGACAGAAGACAGGAAGA
TCTTTGTGGAGAAGATGGAGGAAATCAACGAGCATGTCGC
CCCCAGTGAGGCGGCCATGTCTGTTGAACAGGCAGTGGCT
GCAGCTGAAAGACTTGGTTATCCGGTTCTGGTCCGTTCTG
CGTTTGCCTTGGGTGGACTGGGTTCAGGCTTTGCCAATAA
CAGAGATGAGATGATCACGTTGGTCACTCAGGCCTTTGCC
CACACATCACAAGTCCTGGTTGACAAATCGCTTAAAGGCT
GGAAGGAAATTGAGTATGAAGTAGTGCGGGATGCCTATGA
CAATTGTGTTACGGTGTGTAACATGGAGAACATCGATCCT
CTAGGAATTCACACTGGAGAGTCCATAGTGGTAGCTCCTA
GTCAGACACTAAACGACTATGAATACAACATGCTGAGAAA
CACAGCCATCAAAGTTATTCGCCACTTGGGTGTTGTGGGA
GAGTGCAACATTCAGTATGCCCTGAATCCTGAATCAGAGC
AGTACTACATCATTGAAGTCAATGCCCGTCTCTCTCGAAG
CTCTGCATTGGCCAGTAAGGCCACAGGTTACCCGCTGGCC
TACGTGGCTGCTAAACTCAGCTTGGGAATCCCTCTGCCCG
TGCTCAAAAATTCAGTGACTAATTCCACAACCGCCAACTT
TGAGCCCAGTCTGGATTACTGCGTGGTGAAGGTTCCTCGC
TGGGATTTAAGCAAGTTCCTCAGAGTCAGCACTAAAATAG
GCAGCTCCATGAAGAGTGTTGGAGAAGTGATGGCCATCGG
CCGCAGCTTTGAAGAGGCCTTCCAGAAAGCTTTGAGAATG
GTAGATGAGAACTGCGTTGGATTCGATCACACCATCAAGC
CAGAGTCGGAAGAGGAGTTGCAGACTCCCACAGACAAGCG
CATCTTTGTTCTGGCAGCTGCTCTGCATGCTGGATATACA
GTAGAGCGGCTCTATGAGCTGACCAAGATAGACCACTGGT
TTCTGCATAAGATGAAGAACATCGCAGACCACAAGAAGCT
TCTGGAGACGTATAAGCAGGATGAGAGTGCAATGCCTCCA
GAAATCATGAGGAAAGCCAAGCAACTGGGCTTCTCTGACA
AACAGATCGCTCAAGCTGTGCAAAGCACTGAACTGGCTGT
GAGGAAGTTGAGACGGGACTGGAAGATCTTTCCAGTGGTC
AAACAGATCGACACTGTGGCTGCAGAGTGGCCCGCTCAAA
CCAACTACCTGTACCTGACATATCACGGCTCAGAAAGTGA
CGTAGTGTTCGAGCAACCACATGTCATGGTGATTGGCTCC
GGGGTTTACCGCATTGGCAGCAGTGTGGAGTTTGACTGGT
GTGCTGTTGGGTGTATTATGGAACTCAGAAAGATGGGATA
TAAAACCATTATGGTGAACTACAACCCGGAAACAGTCAGC
ACTGATTATGATATGTGTGATAGACTGTATTTTGATGAGA
TCTCCTTTGAGGTGGTGATGGATATCTATGAGATGGAGAA
TCCAGAGGGTGTTATTCTGTCTATGGGTGGGCAGCTGCCC
AATAACATCGCCATGTCCCTTCACAGACAGCAGTGCAGGA
TCCTGGGCACCTCACCTGAGTTCATAGACAATGCGGAAAA
CCGCTTCAAATTCTCCAGAATGCTGGACACCATCGGGATC
AGCCAGCCTCGGTGGAAAGAGCTCTCTGATACTGAGTCTG
CTGTGAATTTCTGTGAGACGGTGGGTTATCCCTGCTTGGT
GAGGCCATCATATGTTCTGAGCGGAGCTGCGATGAACGTG
GCCTACTCAGACACGGATATGGAGAAGTTTCTGAGCAGTG
CTGTTGCTGTGTCGAAGGAACACCCTGTCGTTATTTCCAA
ATTCATTCAGGAGGCCAAGGAGATTGATGTGGACGCCGTG
GCCTGTGATGGAGAGGTTATTGCCATCGCGGTTTCTGAGC
ATGTGGAGAACGCAGGGGTTCATTCTGGAGACGCCACACT
GGTGACTCCTCCACAGGACATTAACCAGAAAACCATGGAG
CGCATTAAGATGATCGTTCATGCTATTGGGCAGGAGCTTC
AGGTCACTGGCCCGTTCAACCTGCAGCTCATTGCCAAGGA
TGATCAGCTGAAGGTGATCGAGTGCAATGTGCGAGTCTCG
CGCTCCTTCCCTTATGTGTCCAAAACACTTGGTGTGGATC
TTGTCGCGCTTGCAACAAGAGTCATCTTGGGAGAGGAAGT
GGAAGCTGTTGGGCTGATGAGGGGGAATGGCATTGTTGGA
GTTAAGGTTCCTCAGTTCTCCTTCTCCCGCCTGGCTGGAG
CAGATGTGGTTTTGGGTGTTGAGATGACCAGCACTGGAGA
AGTGGCCTGCTTCGGGGAGAACCGATATGAGGCCTATCTC
AAAGCCATGCTTAGCACCGGCTTCAAGATCCCTAAAAAGA
ACATTCTGCTCTCTATTGGTAGTTACAAGAATAAGAGTGA
GCTGCTGCCCACAGTACAGACTTTGGAGAGTTTGGGTTAT
AACTTGTATGCAAGTCTTGGCACTGCTGACTTCTACACTG
AACATGGAGTCAAGGTAATGGCAGTGGACTGGCCATTTGA
AGAGGAGAGTGACTGTCCAAATAAGGACAAACAGCGCAAC
ATCATGGACTATCTGGAGGAGAACCATTTTGACTTGGTCA
TCAATCTGTCTATGAGGAACTCTGGAGGAAGACGCTTGTC
CTCTTTTGTGACCAAAGGATACCGAACTCGTCGAATGGCT
ATTGACTTCTCAGTGCCACTCATAACTGACATAAAGTGCA
CTAAGCTCTTTGTTCAAGCACTGAAGCAAATTGGACAGGC
TCCTCGCGTGAAGACACATGTAGACAGCATGACCTCACAG
AAACTCATCCGTTTGCCAGGTTTGATTGATGTCCATGTAC
ATCTGCGAGAGCCTGGTGCCACCCATAAAGAAGACTTCTC
GTCGGGCACTGCTGCTGCACTCGCTGGAGGTATCACTATG
GTGTGTGCAATGCCCAACACTAACCCTGCCATCATCGACC
CCAACTCCTTTACTATGGCACAAAAGCTTGCAAAGGCTGG
GTGCCGCTGTGATTATGCACTTTTCGTGGGGGCTTCATCC
GACAACGCTGCTCTACTTCCGTCCATTGCAAGCTCTACAG
CTGGTCTGAAGATGTACTTGAATGACACCTACTCTACTTT
GAAGATGGACAATGTCTCGCTGTGGATGGAGCACTTCGAA
AAGTGGCCGAAGCACTTGCCCATTGTGGCACATGCAGAGA
AACAGACAGTGGCTGCAATCCTGCTGGTGGCACAGCTCTA
TCAGAGACCTGTTCATATCTGCCACGTTGCCAAGAAAGAA
GAGATTCTGATCATTCGAGCTGCTAAACAAAAAGGGATCC
AGGTGACGTGTGAAGTGGCACCTCACCATCTTTTCTTGTG
TGAAGATAACGTGCCCGTCATTGGAAAAGACAAGGCACAA
GTGCGCCCCATGCTGGGCACACGCGAGGACATGGAGGCAT
TATGGGAAAATCTAGACATCATTGACTGTTTTGCAACAGA
CCACGCTCCACATTCAGCGGAAGAGAAGATCTCAGAGAAG
CCTCCTCCAGGTTACCCAGGTCTGGAGACGATGCTGCCTC
TGCTGTTCACGGCCGTCAGCGAGGGTCGCCTTACAGTCGA
TGACATTATCAAGAGGCTGTATGAAAACCCCCGAAAAATC
TTCTCCCTTCCTGCTCAAGAAGACACCTATGTTGAGGTGG
ATTTGGAGCAGGAGTGGATCATTCCAAAGCACATGCAATT
CACCAAGTCAAAGTGGACACCTTTTGAGGGCATGAAAGTG
AAGGGAAAAGTCATGAGGGTTGTGCTCAGAGGCGAAGTGG
CTTATATTGATGGACAGGTGTTGGTACCTCCTGGTTATGG
TCAGGATGTAAAGTCTTGGTCAGCAACCCCAACAGCAACC
ACTGAGGTGATAATGGATGCTCCTAAGCGTGTGATCGAGG
CAATGACTCCTGAGCGCCCCCGTCAGGCGGCACCTGTTGA
TGTGGTCCGCAGTCGTGCCCCGAGCCCACGCCGCTCAGCT
GGAGATGGACGGTTCATTCTGCCACCTCGTATCCACCGGT
CATCTGATCCCGGCCTGCCTCCAGAATTGGCTCTACCAGC
AGAGGCATACGCTCACCCTCCTCCCCTGGCCAGGATCCTG
TCACCTCAAGCTGGGCAACCGCAGATCCTGCCTCACCCTC
AAACCTCCCCGCTGCTGCACCCGCTGGTGGGCCAGCACAT
CCTGTCTGTGCGCCAGTTCAGCAAGGAACAGATGTCACAT
CTGTTCAATGTGGCACATACTCTTCGTCTCATGGTGCAGA
AGGAACGACCGTTGGATATTTTGAAGGGTAAAGTCATGGC
CTCTATGTTTTACGAGGTGAGCACTCGCACCAGCAGTTCA
TTCGCAGCAGCCATGCATCGTCTGGGAGGGTCTGTGGTGC
ATTTCTGCGAGTCCACATCTTCAACGCAGAAGGGCGAGTC
TCTGGTGGACTCTGTGAACACCATGAGCTGCTATGCTGAT
GTCATTGTTCTGCGGCACCCCATACCAGGAGCTGTAGAGA
GTGCGGCAAGACATTGTCGGCGTCCGGTGATCAATGCTGG
TGATGGGGTCGGAGAACATCCAACTCAGGCCCTTCTGGAC
ATCTTTACAATCCGAGAAGAGCTGGGAACGGTCAATGGCA
TGACTATTACCATGGTAGGCGACCTGAAACATGGGCGAAC
TGTGCATTCTCTAGCTAGACTTCTCACTCAGTACAGAATC
ACTTTACGCTATGTGGCTCCAAAGAATCTGAGCATGCCTG
CAGAAATCATCGACTTTGTGGCCTCCAAGGGAATTAAACA
GGAGGAGTTTAATAGCATTGAAGAAGCCCTTCCTGACACT
GACGTTCTGTACATGACGAGAATACAGAAAGAGCGGTTCT
CTTCTGAAAAAGAGTACAATGCGTGTTTTGGCCAGTTCAT
CCTAACCCCACATATCATGACGGGAGCCAAAAGAAAGATG
GTGGTCATGCATCCTCTTCCCAGAGTCAACGAGATCAGTG
TGGAAGTGGACACAGATCCTCGGGCTGCTTACTTCCGGCA
GGCAGAGAACGGGATGTATATTCGGATGGCACTACTGGCT
ACTGTATTGGGGCGATGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations