header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-804
Transcript Name: cad-203
Previous Name: cad-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000006673 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000006673|OTTDARG00000006087|ZDB-GENE-021030-4 cad|OTTDARP00000005939 cad-001 LG_ BX511178.6 Danio rerio protein_coding KNOWN, 7486 bp
AGGGACAGCATGCTATTTGGCCTAGATAACAACAACAACA
TCTAAAAGGCGCATTTATTTACTCCGCATCCGGGTGAACA
TCACCTTGCGCGGCGTGCTTTTCACGTGGGCAAACTTCGG
CGATAAGGGAGAAACAGAAGTCATTCAGTTCAACTCGATT
ATACTTTTTGTTAACGCTAGATATTCGCTTAGTGTTTAGA
AATACGAACAGTTTAGTCATGTCGCTGAAAATGGCATCTT
TAGTGCTGGAGGACGGGACGACATTTAAAGGCCGTCTGTT
CGGTGCCGTATCTTCAGTGTCTGGTGAAGTTGTTTTCCAG
ACAGGAATGGTGGGTTATCCGGAGGCACTCACAGATCCGT
CTTACAAGTCCCAAATACTAACTCTGACGTACCCGATGAT
TGGCAATTATGGTATTCCAAAAGATGAAGATGGAGAGTTT
GGACTCAGCAAGTGGTTTGAATCTTCCCAAATCCATGCTG
CTGCTCTCATTGTTGGGGAGGTTTCGGAGAATCCCAGTCA
CTGGAGCGCCGCCAAATCTCTGGATGAGTGGCTCAGAGAG
CAAGGCATCCCTGGCCTCCAAGGTGTTGACACTCGATGCT
TGACCAAAAAGATCAGAGAGAAGGGAACCATGTTGGGAAA
ACTTGTGGTGGAAGGAACTCCAGCCGACAATATTCCGTTT
GACAATCCAGATGCCCGAAACCTTGTTAAAGAAGTTTCCA
TGAAAGCACCAAAAGTGTTTAATCCAGAGGGCACAGTGAG
AATCACTGCTATAGACTGTGGCATCAAGTACAACCAGATA
CGTTGCTTGTGCCAGAGAGGCGCCCGGGTCACTGTTGTCC
CCTGGGATCAACCTCTGGACAGCAATGACTTTGATGGGTT
GTTTATCAGCAACGGTCCTGGCAATCCTGAGTACTGTAAG
GAGACTGTAGAGAATATACGCAAAGTGGCATGTGTGGAGA
ATCCCAAACCTATCTTTGGAATTTGCTTGGGCCATCAGCT
GCTGTCTTTGGTCATTGGCGCAAAGACATACAAAATGAAG
TACGGTAATCGTGGCCATAATCAGCCATGCATCCATAAAG
GAACCAGTCGCTGTTACATCACCTCTCAGAATCACGGGTT
TGCTGTGGATCCAGAAACTCTTCCAAAGGACTGGGATGTG
CTCTTCACCAATGCTAATGACCAAACCAGCGAGGGCATCG
TTCATAATCACAAACCACTCTTCAGTGTCCAGTTCCATCC
TGAACACATGGCAGGTCCCACAGACCTTGTTGGTCTCTTT
GATGTGTTTCTGGATACAGTCAGAGATGTAAAGGAGAACA
AGGCTGGAAAATCAGTGAAGCAAAGATTAATGGAGCACCT
CACCTTTCCTGGATCTCCTGACCCAAATGCCTTTGTTCGA
CCACGTAAAGTTCTGGTTCTGGGTTCAGGTGGTCTTTCCA
TTGGACAGGCTGGAGAGTTTGACTATTCTGGATCTCAGGC
TATAAAAGCTATGAAAGAAGAGAATATCCAAACCATTCTC
ATCAACCCAAACATTGCCACAGTACAAACCTCAAAGGGCC
TGGCAGACAAAGTCTACTTCCTTCCGATCACACCAGAGTA
CGTCACACAGGTGATAAAGAACGAGCGTCCAGATGGGGTG
TTGCTCACTTTCGGAGGTCAGACAGCCCTGAACTGTGGTG
TGGAACTCAAAAAACAAGGAGTGCTGGAAAAATACAAAGT
GCGTGTGCTTGGTACCCCAGTGGCCTCCATAGAGATGACA
GAAGACAGGAAGATCTTTGTGGAGAAGATGGAGGAAATCA
ACGAGCATGTCGCCCCCAGTGAGGCGGCCATGTCTGTTGA
ACAGGCAGTGGCTGCAGCTGAAAGACTTGGTTATCCGGTT
CTGGTCCGTTCTGCGTTTGCCTTGGGTGGACTGGGTTCAG
GCTTTGCCAATAACAGAGATGAGATGATCACGTTGGTCAC
TCAGGCCTTTGCCCACACATCACAAGTCCTGGTTGACAAA
TCGCTTAAAGGCTGGAAGGAAATTGAGTATGAAGTAGTGC
GGGATGCCTATGACAATTGTGTTACGGTGTGTAACATGGA
GAACATCGATCCTCTAGGAATTCACACTGGAGAGTCCATA
GTGGTAGCTCCTAGTCAGACACTAAACGACTATGAATACA
ACATGCTGAGAAACACAGCCATCAAAGTTATTCGCCACTT
GGGTGTTGTGGGAGAGTGCAACATTCAGTATGCCCTGAAT
CCTGAATCAGAGCAGTACTACATCATTGAAGTCAATGCCC
GTCTCTCTCGAAGCTCTGCATTGGCCAGTAAGGCCACAGG
TTACCCGCTGGCCTACGTGGCTGCTAAACTCAGCTTGGGA
ATCCCTCTGCCCGTGCTCAAAAATTCAGTGACTAATTCCA
CAACCGCCAACTTTGAGCCCAGTCTGGATTACTGCGTGGT
GAAGGTTCCTCGCTGGGATTTAAGCAAGTTCCTCAGAGTC
AGCACTAAAATAGGCAGCTCCATGAAGAGTGTTGGAGAAG
TGATGGCCATCGGCCGCAGCTTTGAAGAGGCCTTCCAGAA
AGCTTTGAGAATGGTAGATGAGAACTGCGTTGGATTCGAT
CACACCATCAAGCCAGAGTCGGAAGAGGAGTTGCAGACTC
CCACAGACAAGCGCATCTTTGTTCTGGCAGCTGCTCTGCA
TGCTGGATATACAGTAGAGCGGCTCTATGAGCTGACCAAG
ATAGACCACTGGTTTCTGCATAAGATGAAGAACATCGCAG
ACCACAAGAAGCTTCTGGAGACGTATAAGCAGGATGAGAG
TGCAATGCCTCCAGAAATCATGAGGAAAGCCAAGCAACTG
GGCTTCTCTGACAAACAGATCGCTCAAGCTGTGCAAAGCA
CTGAACTGGCTGTGAGGAAGTTGAGACGGGACTGGAAGAT
CTTTCCAGTGGTCAAACAGATCGACACTGTGGCTGCAGAG
TGGCCCGCTCAAACCAACTACCTGTACCTGACATATCACG
GCTCAGAAAGTGACGTAGTGTTCGAGCAACCACATGTCAT
GGTGATTGGCTCCGGGGTTTACCGCATTGGCAGCAGTGTG
GAGTTTGACTGGTGTGCTGTTGGGTGTATTATGGAACTCA
GAAAGATGGGATATAAAACCATTATGGTGAACTACAACCC
GGAAACAGTCAGCACTGATTATGATATGTGTGATAGACTG
TATTTTGATGAGATCTCCTTTGAGGTGGTGATGGATATCT
ATGAGATGGAGAATCCAGAGGGTGTTATTCTGTCTATGGG
TGGGCAGCTGCCCAATAACATCGCCATGTCCCTTCACAGA
CAGCAGTGCAGGATCCTGGGCACCTCACCTGAGTTCATAG
ACAATGCGGAAAACCGCTTCAAATTCTCCAGAATGCTGGA
CACCATCGGGATCAGCCAGCCTCGGTGGAAAGAGCTCTCT
GATACTGAGTCTGCTGTGAATTTCTGTGAGACGGTGGGTT
ATCCCTGCTTGGTGAGGCCATCATATGTTCTGAGCGGAGC
TGCGATGAACGTGGCCTACTCAGACACGGATATGGAGAAG
TTTCTGAGCAGTGCTGTTGCTGTGTCGAAGGAACACCCTG
TCGTTATTTCCAAATTCATTCAGGAGGCCAAGGAGATTGA
TGTGGACGCCGTGGCCTGTGATGGAGAGGTTATTGCCATC
GCGGTTTCTGAGCATGTGGAGAACGCAGGGGTTCATTCTG
GAGACGCCACACTGGTGACTCCTCCACAGGACATTAACCA
GAAAACCATGGAGCGCATTAAGATGATCGTTCATGCTATT
GGGCAGGAGCTTCAGGTCACTGGCCCGTTCAACCTGCAGC
TCATTGCCAAGGATGATCAGCTGAAGGTGATCGAGTGCAA
TGTGCGAGTCTCGCGCTCCTTCCCTTATGTGTCCAAAACA
CTTGGTGTGGATCTTGTCGCGCTTGCAACAAGAGTCATCT
TGGGAGAGGAAGTGGAAGCTGTTGGGCTGATGAGGGGGAA
TGGCATTGTTGGAGTTAAGGTTCCTCAGTTCTCCTTCTCC
CGCCTGGCTGGAGCAGATGTGGTTTTGGGTGTTGAGATGA
CCAGCACTGGAGAAGTGGCCTGCTTCGGGGAGAACCGATA
TGAGGCCTATCTCAAAGCCATGCTTAGCACCGGCTTCAAG
ATCCCTAAAAAGAACATTCTGCTCTCTATTGGTAGTTACA
AGAATAAGAGTGAGCTGCTGCCCACAGTACAGACTTTGGA
GAGTTTGGGTTATAACTTGTATGCAAGTCTTGGCACTGCT
GACTTCTACACTGAACATGGAGTCAAGGTAATGGCAGTGG
ACTGGCCATTTGAAGAGGAGAGTGACTGTCCAAATAAGGA
CAAACAGCGCAACATCATGGACTATCTGGAGGAGAACCAT
TTTGACTTGGTCATCAATCTGTCTATGAGGAACTCTGGAG
GAAGACGCTTGTCCTCTTTTGTGACCAAAGGATACCGAAC
TCGTCGAATGGCTATTGACTTCTCAGTGCCACTCATAACT
GACATAAAGTGCACTAAGCTCTTTGTTCAAGCACTGAAGC
AAATTGGACAGGCTCCTCGCGTGAAGACACATGTAGACAG
CATGACCTCACAGAAACTCATCCGTTTGCCAGGTTTGATT
GATGTCCATGTACATCTGCGAGAGCCTGGTGCCACCCATA
AAGAAGACTTCTCGTCGGGCACTGCTGCTGCACTCGCTGG
AGGTATCACTATGGTGTGTGCAATGCCCAACACTAACCCT
GCCATCATCGACCCCAACTCCTTTACTATGGCACAAAAGC
TTGCAAAGGCTGGGTGCCGCTGTGATTATGCACTTTTCGT
GGGGGCTTCATCCGACAACGCTGCTCTACTTCCGTCCATT
GCAAGCTCTACAGCTGGTCTGAAGATGTACTTGAATGACA
CCTACTCTACTTTGAAGATGGACAATGTCTCGCTGTGGAT
GGAGCACTTCGAAAAGTGGCCGAAGCACTTGCCCATTGTG
GCACATGCAGAGAAACAGACAGTGGCTGCAATCCTGCTGG
TGGCACAGCTCTATCAGAGACCTGTTCATATCTGCCACGT
TGCCAAGAAAGAAGAGATTCTGATCATTCGAGCTGCTAAA
CAAAAAGGGATCCAGGTGACGTGTGAAGTGGCACCTCACC
ATCTTTTCTTGTGTGAAGATAACGTGCCCGTCATTGGAAA
AGACAAGGCACAAGTGCGCCCCATGCTGGGCACACGCGAG
GACATGGAGGCATTATGGGAAAATCTAGACATCATTGACT
GTTTTGCAACAGACCACGCTCCACATTCAGCGGAAGAGAA
GATCTCAGAGAAGCCTCCTCCAGGTTACCCAGGTCTGGAG
ACGATGCTGCCTCTGCTGTTCACGGCCGTCAGCGAGGGTC
GCCTTACAGTCGATGACATTATCAAGAGGCTGTATGAAAA
CCCCCGAAAAATCTTCTCCCTTCCTGCTCAAGAAGACACC
TATGTTGAGGTGGATTTGGAGCAGGAGTGGATCATTCCAA
AGCACATGCAATTCACCAAGTCAAAGTGGACACCTTTTGA
GGGCATGAAAGTGAAGGGAAAAGTCATGAGGGTTGTGCTC
AGAGGCGAAGTGGCTTATATTGATGGACAGGTGTTGGTAC
CTCCTGGTTATGGTCAGGATGTAAAGTCTTGGTCAGCAAC
CCCAACAGCAACCACTGAGGTGATAATGGATGCTCCTAAG
CGTGTGATCGAGGCAATGACTCCTGAGCGCCCCCGTCAGG
CGGCACCTGTTGATGTGGTCCGCAGTCGTGCCCCGAGCCC
ACGCCGCTCAGCTGGAGATGGACGGTTCATTCTGCCACCT
CGTATCCACCGGTCATCTGATCCCGGCCTGCCTCCAGAAT
TGGCTCTACCAGCAGAGGCATACGCTCACCCTCCTCCCCT
GGCCAGGATCCTGTCACCTCAAGCTGGGCAACCGCAGATC
CTGCCTCACCCTCAAACCTCCCCGCTGCTGCACCCGCTGG
TGGGCCAGCACATCCTGTCTGTGCGCCAGTTCAGCAAGGA
ACAGATGTCACATCTGTTCAATGTGGCACATACTCTTCGT
CTCATGGTGCAGAAGGAACGACCGTTGGATATTTTGAAGG
GTAAAGTCATGGCCTCTATGTTTTACGAGGTGAGCACTCG
CACCAGCAGTTCATTCGCAGCAGCCATGCATCGTCTGGGA
GGGTCTGTGGTGCATTTCTGCGAGTCCACATCTTCAACGC
AGAAGGGCGAGTCTCTGGTGGACTCTGTGAACACCATGAG
CTGCTATGCTGATGTCATTGTTCTGCGGCACCCCATACCA
GGAGCTGTAGAGAGTGCGGCAAGACATTGTCGGCGTCCGG
TGATCAATGCTGGTGATGGGGTCGGAGAACATCCAACTCA
GGCCCTTCTGGACATCTTTACAATCCGAGAAGAGCTGGGA
ACGGTCAATGGCATGACTATTACCATGGTAGGCGACCTGA
AACATGGGCGAACTGTGCATTCTCTAGCTAGACTTCTCAC
TCAGTACAGAATCACTTTACGCTATGTGGCTCCAAAGAAT
CTGAGCATGCCTGCAGAAATCATCGACTTTGTGGCCTCCA
AGGGAATTAAACAGGAGGAGTTTAATAGCATTGAAGAAGC
CCTTCCTGACACTGACGTTCTGTACATGACGAGAATACAG
AAAGAGCGGTTCTCTTCTGAAAAAGAGTACAATGCGTGTT
TTGGCCAGTTCATCCTAACCCCACATATCATGACGGGAGC
CAAAAGAAAGATGGTGGTCATGCATCCTCTTCCCAGAGTC
AACGAGATCAGTGTGGAAGTGGACACAGATCCTCGGGCTG
CTTACTTCCGGCAGGCAGAGAACGGGATGTATATTCGGAT
GGCACTACTGGCTACTGTATTGGGGCGATGAAGGGACCAT
AATGGTTCAGTCTTGACATTTGGCAGTAAAGGGAAATATT
TTATTGCTTACTGATGTGATTCCGTGTTTATTGTTCACTC
TATATTGCTGCATTAAGTGAGATTTGTGGGTTGAAGTACC
CAGAATTGTCTTTCATTCCGGTATTGACCACAATAACATT
CCATATTGAGTATTTTACCTAAAACACGCACATTAAATCA
ACCACAGTGGAGTGTGGTTTGACATTTTTTGTTTGTTTGT
TTTTTTCATTTATTGTAGTGCTCTAGCATGTGTAGAGAAT
TGCTCAAGTGTCATTTCAGTGTCTTTAAACTTGCAAACAG
TTCTACAACTACATATTTTACTGTTATAAATGCAAATACT
TTATTCTTTTCTTGTCCATTTACAACAATGCAGATGTATT
TTCATGTCACCATATTCATTTTTTCCTATCCAATTGGGAC
CAGACTTTAGTAACCCAATCCTCTCAGATAAATAGATAGT
GTGGTAGGAGGATTATTCTTCTATACTGAGTAAAGGTTTT
GTAGTTGAAATTTTTAGACAATAAAAATGGCAATCTTTGA
TCTTTC

cad TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA cad-004 (1) 525
cad-005 (1) 791
mRNA cad-201 (1) 1454
cad-203 7486
 Withdrawn Transcriptsextinct
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cad-203 Contained in:

OTHER cad-203 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000006673 (1)
  • Ensembl_Trans:ENSDART00000153310 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CA975266 (1) 909 bp
    GenBank:CA470269 (1) 896 bp
    GenBank:CD754589 (1) 872 bp
    GenBank:CD052984 (1) 851 bp
    GenBank:CD753064 (1) 847 bp
    GenBank:CD754564 (1) 846 bp
    GenBank:CK148564 (1) 843 bp
    GenBank:CK148419 (1) 823 bp
    GenBank:CD752212 (1) 811 bp
    GenBank:CK148232 (1) 810 bp
    GenBank:CK146065 (1) 803 bp
    GenBank:AI721634 (1) 735 bp
    GenBank:CK142584 (1) 735 bp
    GenBank:BI890200 (1) 724 bp
    GenBank:CD752237 (1) 701 bp
    GenBank:CD594823 (1) 650 bp
    GenBank:CD281894 (1) 636 bp
    GenBank:BU670739 (1) 629 bp
    GenBank:BM859325 (1) 594 bp
    GenBank:CD752901 (1) 564 bp
    GenBank:AI942850 (1) 543 bp
    GenBank:AI722689 (1) 539 bp
    GenBank:AL923973 (1) 539 bp
    GenBank:CD281893 (1) 517 bp
    GenBank:BM037072 (1) 480 bp
    GenBank:CB364699 (1) 469 bp
    GenBank:AI396978 (1) 430 bp
    GenBank:AL926880 (1) 415 bp
    GenBank:BM403298 (1) 415 bp
    GenBank:AI396981 (1) 413 bp
    CITATIONS (2)