header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-810
Transcript Name: cad-201
Previous Name: cad-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000006679 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000006679|OTTDARG00000006087|ZDB-GENE-021030-4 cad|OTTDARP00000005944 cad-002 LG_ BX511178.6 Danio rerio protein_coding KNOWN, 1454 bp
ACAGCTCTATCAGAGACCTGTTCATATCTGCCACGTTGCC
AAGAAAGAAGAGATTCTGATCATTCGAGCTGCTAAACAAA
AAGGGATCCAGGTGACGTGTGAAGTGGCACCTCACCATCT
TTTCTTGTGTGAAGATAACGTGCCCGTCATTGGAAAAGAC
AAGGCACAAGTGCGCCCCATGCTGGGCACACGCGAGGACA
TGGAGGCATTATGGGAAAATCTAGACATCATTGACTGTTT
TGCAACAGACCACGCTCCACATTCAGCGGAAGAGAAGATC
TCAGAGAAGCCTCCTCCAGGTTACCCAGGTCTGGAGACGA
TGCTGCCTCTGCTGTTCACGGCCGTCAGCGAGGGTCGCCT
TACAGTCGATGACATTATCAAGAGGCTGTATGAAAACCCC
CGAAAAATCTTCTCCCTTCCTGCTCAAGAAGACACCTATG
TTGAGGTATTTCATGAAAGAGTGCAGGTGGATTTGGAGCA
GGAGTGGATCATTCCAAAGCACATGCAATTCACCAAGTCA
AAGTGGACACCTTTTGAGGGCATGAAAGTGAAGGGAAAAG
TCATGAGGGTTGTGCTCAGAGGCGAAGTGGCTTATATTGA
TGGACAGGTGTTGGTACCTCCTGGTTATGGTCAGGATGTA
AAGTCTTGGTCAGCAACCCCAACAGCAACCACTGAGGTGA
TAATGGATGCTCCTAAGCGTGTGATCGAGGCAATGACTCC
TGAGCGCCCCCGTCAGGCGGCACCTGTTGATGTGGTCCGC
AGTCGTGCCCCGAGCCCACGCCGCTCAGCTGGAGATGGAC
GGTTCATTCTGCCACCTCGTATCCACCGGTCATCTGATCC
CGGCCTGCCTCCAGGTTTCAAAAGATCTACCATGCATCCC
CAAAAGGCGTTTGAATTGGCTCTACCAGCAGAGGCATACG
CTCACCCTCCTCCCCTGGCCAGGATCCTGTCACCTCAAGC
TGGGCAACCGCAGATCCTGCCTCACCCTCAAACCTCCCCG
CTGCTGCACCCGCTGGTGGGCCAGCACATCCTGTCTGTGC
GCCAGTTCAGCAAGGAACAGATGTCACATCTGTTCAATGT
GGCACATACTCTTCGTCTCATGGTGCAGAAGGAACGACCG
TTGGATATTTTGAAGGGTAAAGTCATGGCCTCTATGTTTT
ACGAGGTGAGCACTCGCACCAGCAGTTCATTCGCAGCAGC
CATGCATCGTCTGGGAGGGTCTGTGGTGCATTTCTGCGAG
TCCACATCTTCAACGCAGAAGGGCGAGTCTCTGGTGGACT
CTGTGAACACCATGAGCTGCTATGCTGATGTCATTGTTCT
GCGGCACCCCATACCAGGAGCTGTAGAGAGTGCGGCAAGA
CATTGTCGGCGTCCGGTGATCAATGCTGGTGATGGGGTCG
GAGAACATCCAACTCAGGCCCTTCTGGACATCTTTACAAT
CCGAGAAGAGCTGG

cad TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA cad-004 (1) 525
cad-005 (1) 791
mRNA cad-201 1454
cad-203 (1) 7486
 Withdrawn Transcriptsextinct
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cad-201 Contained in:

OTHER cad-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000006679 (1)
  • Ensembl_Trans:ENSDART00000125333 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CA469859 (1) 925 bp
    GenBank:CD752467 (1) 885 bp
    CITATIONS (2)