Transcript

cad-201

ID
ZDB-TSCRIPT-090929-810
Name
cad-201
Previous Names
  • cad-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000006679 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000006679|OTTDARG00000006087|ZDB-GENE-021030-4 cad|OTTDARP00000005944 cad-002 LG_ BX511178.6 Danio rerio protein_coding KNOWN, 1454 bp
ACAGCTCTATCAGAGACCTGTTCATATCTGCCACGTTGCC
AAGAAAGAAGAGATTCTGATCATTCGAGCTGCTAAACAAA
AAGGGATCCAGGTGACGTGTGAAGTGGCACCTCACCATCT
TTTCTTGTGTGAAGATAACGTGCCCGTCATTGGAAAAGAC
AAGGCACAAGTGCGCCCCATGCTGGGCACACGCGAGGACA
TGGAGGCATTATGGGAAAATCTAGACATCATTGACTGTTT
TGCAACAGACCACGCTCCACATTCAGCGGAAGAGAAGATC
TCAGAGAAGCCTCCTCCAGGTTACCCAGGTCTGGAGACGA
TGCTGCCTCTGCTGTTCACGGCCGTCAGCGAGGGTCGCCT
TACAGTCGATGACATTATCAAGAGGCTGTATGAAAACCCC
CGAAAAATCTTCTCCCTTCCTGCTCAAGAAGACACCTATG
TTGAGGTATTTCATGAAAGAGTGCAGGTGGATTTGGAGCA
GGAGTGGATCATTCCAAAGCACATGCAATTCACCAAGTCA
AAGTGGACACCTTTTGAGGGCATGAAAGTGAAGGGAAAAG
TCATGAGGGTTGTGCTCAGAGGCGAAGTGGCTTATATTGA
TGGACAGGTGTTGGTACCTCCTGGTTATGGTCAGGATGTA
AAGTCTTGGTCAGCAACCCCAACAGCAACCACTGAGGTGA
TAATGGATGCTCCTAAGCGTGTGATCGAGGCAATGACTCC
TGAGCGCCCCCGTCAGGCGGCACCTGTTGATGTGGTCCGC
AGTCGTGCCCCGAGCCCACGCCGCTCAGCTGGAGATGGAC
GGTTCATTCTGCCACCTCGTATCCACCGGTCATCTGATCC
CGGCCTGCCTCCAGGTTTCAAAAGATCTACCATGCATCCC
CAAAAGGCGTTTGAATTGGCTCTACCAGCAGAGGCATACG
CTCACCCTCCTCCCCTGGCCAGGATCCTGTCACCTCAAGC
TGGGCAACCGCAGATCCTGCCTCACCCTCAAACCTCCCCG
CTGCTGCACCCGCTGGTGGGCCAGCACATCCTGTCTGTGC
GCCAGTTCAGCAAGGAACAGATGTCACATCTGTTCAATGT
GGCACATACTCTTCGTCTCATGGTGCAGAAGGAACGACCG
TTGGATATTTTGAAGGGTAAAGTCATGGCCTCTATGTTTT
ACGAGGTGAGCACTCGCACCAGCAGTTCATTCGCAGCAGC
CATGCATCGTCTGGGAGGGTCTGTGGTGCATTTCTGCGAG
TCCACATCTTCAACGCAGAAGGGCGAGTCTCTGGTGGACT
CTGTGAACACCATGAGCTGCTATGCTGATGTCATTGTTCT
GCGGCACCCCATACCAGGAGCTGTAGAGAGTGCGGCAAGA
CATTGTCGGCGTCCGGTGATCAATGCTGGTGATGGGGTCG
GAGAACATCCAACTCAGGCCCTTCTGGACATCTTTACAAT
CCGAGAAGAGCTGG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations