Transcript

cad-005

ID
ZDB-TSCRIPT-130528-415
Name
cad-005
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000058667 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000058667|OTTDARG00000006087|ZDB-GENE-021030-4 cad|no_translation cad-005 LG_ BX511178.6 Danio rerio protein_coding KNOWN, 791 bp
CTTCTACCAGGGTAAAGTCATGGCCTCTATGTTTTACGAG
GTGAGCACTCGCACCAGCAGTTCATTCGCAGCAGCCATGC
ATCGTCTGGGAGGGTCTGTGGTGCATTTCTGCGAGTCCAC
ATCTTCAACGCAGAAGGGCGAGTCTCTGGTGGACTCTGTG
AACACCATGAGCTGCTATGCTGATGTCATTGTTCTGCGGC
ACCCCATACCAGGAGCTGTAGAGAGTGCGGCAAGACATTG
TCGGCGTCCGGTGATCAATGCTGGTGATGGGGTCGGAGAA
CATCCAACTCAGGCCCTTCTGGACATCTTTACAATCCGAG
AAGAGCTGGGAACGGTCAATGGCATGACTATTACCATGGT
AGGCGACCTGAAACATGGGCGAACTGTGCATTCTCTAGCT
AGACTTCTCACTCAGTACAGAATCACTTTACGCTATGTGG
CTCCAAAGAATCTGAGCATGCCTGCAGAAATCATCGACTT
TGTGGCCTCCAAGGGAATTAAACAGGTACTTTTATAATTT
CATGTAAGAATTCGGGAGTGGACGTTAACTTGGGTCCTTG
CCATTTATTTTGTATAATTTTTTTTATCCTCAAGCATGTG
TAAACATTATAAACTCTATTCGCAGGAGGAGTTTAATAGC
ATTGAAGAAGCCCTTCCTGACACTGACGTTCTGTACATGA
CGAGAATACAGAAAGAGCGGTTCTCTTCTGAAAAAGAGTA
CAATGCGGTGGGAGATTTTTACTGATGTCATGTCACTGTG
TATTTATTTTTTTAAATGCTGTAGGTTTATA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations