Transcript

kdm1a-005

ID
ZDB-TSCRIPT-110325-627
Name
kdm1a-005
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000049903 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000049903|OTTDARG00000035108|ZDB-GENE-030131-7828 kdm1a|no_translation kdm1a-005 LG_ AL844186.7 Danio rerio protein_coding KNOWN, 975 bp
GACAGTCGTCTGTTTCTTTGTGTGAAACCCCCCACAGCAG
CGAGGAGGAGAAGCCTCTGTCATCTGTGATGTTGTCCAAT
AAGAAGTCAGACCCAGGCTCCTCCTCTTCGTCAGGGGGTA
ATGGTGGTGATCGTGCTCCTGAAACCCTTGCTGCCCCTCA
GGCTGGTCCAGCGGGTCCCTCTGGCCCGATTTCAGCAGAT
GTGAAAAAGAAAGAAAGAGCCTCCCCAAGTGGAGAACCAG
GTGGACCCCCTCTGCCGCACCCTCCTGGACCAGGAGGCAT
TGATCAAGACTCTGCAGAGGGTCGTAGAACTAGTCGACGT
AAACGGGCAAAGGTAAACATCTCCAATAAATTTTCCTGTT
CTCTTCAAGAGAGAACAGGCACGATTGTGGTAGGCTTATT
TAGCTGAGTTTTACTGGATTTGAAAAAAGTAATATTATGA
ATGATATGGAATTTATTTTTTTTACTTTTAAATAAAAATA
TTATGTCCATTTTGACCCAAAGAGACATACAAAATATAAA
TATTTATAATTTGTAAATGTGATAAAATATGTTGATTTGT
GTAATTTTGCATTATTATAATTGTTTTTATTATTTTAGCA
GTGATGAGTAAATGTTCTTGATTAAGTGCATTCATTCAAG
TTGGTTGGATACTGGTAATTCTTAAATATACATTCTTATT
TTATGAAATTATTAAAAATGTGAACTTCATTCATTAATTT
TTCTTCGGCTTAGTCTCTGATTTATCAGGGGTCGCAACAG
AGGAATGAACTACTCTGGCTTATGTTTTACGCAGCGGATG
TCCTTCCAGCCTCAACCCAGCACCATACTGGGAAACACCC
ATACACTCGTATTAACACACACTCATACACTACAGACAAT
TTTGTTGTAGTATAGTTTTTGTTTTAATTGTGGTTCAGAT
ATTGTTGATGTAAAGAAATTTCACATAATTTCTCAATTGT
TTAATAATATGCTGG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations