ZFIN ID: ZDB-TSCRIPT-110325-625
Transcript Name: kdm1a-201
Previous Name: kdm1a-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000049897 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000049897|OTTDARG00000035108|ZDB-GENE-030131-7828 kdm1a|OTTDARP00000039155 kdm1a-001 LG_ AL844186.7 Danio rerio protein_coding KNOWN, 3367 bp
GTGATTCCAGCAGGGACAGTCGTCTGTTTCTTTGTGTGAA
ACCCCCCACAGCAGCGAGGAGGAGAAGCCTCTGTCATCTG
TGATGTTGTCCAATAAGAAGTCAGACCCAGGCTCCTCCTC
TTCGTCAGGGGGTAATGGTGGTGATCGTGCTCCTGAAACC
CTTGCTGCCCCTCAGGCTGGTCCAGCGGGTCCCTCTGGCC
CGATTTCAGCAGATGTGAAAAAGAAAGAAAGAGCCTCCCC
AAGTGGAGAACCAGGTGGACCCCCTCTGCCGCACCCTCCT
GGACCAGGAGGCATTGATCAAGACTCTGCAGAGGGTCGTA
GAACTAGTCGACGTAAACGGGCAAAGGTGGAGTACAGGGA
GATGGATGAAAGTCTCGCTAATCTTTCGGAGGATGAATAT
TACTCTGAGGAGGAGAGGAATGCTAAAGCTGAGAAAGAAC
GCAAGCAGGTGATTCCTCCACCAGCACCACCAATAGAGGA
GGAGAATGACAGCGAACCTGAGGAACCATCAGGTATCAAC
GGTGTAGAAGGGGCCGCCTTCCAGAGCCGTCTCCCACATG
ACCGTATGACATCACAGGAAGCTGCATGCTTCCCTGACAT
AATTAATGGACCACAACATACTCAGAAAGTGTTCTTGTAT
ATTCGAAACCGCACACTTCAGCTGTGGTTGGACAACCCCA
AAGTCCAGCTCACCTTTGAGGCCACAGTGCAGCAGCTAGA
AGCTCCATACAACAGTGATGCCGTCCTGGTCCACCGGATA
CACAGCTATTTAGAGAGACACGGGTTTATCAACTTTGGCA
TCTACAAGAGAGTAAAGCCTCTACCAACAAAGAAGACTGG
AAAGGTGATCGTGATTGGTGCCGGGGTGTCAGGGCTGGCC
GCAGCAAGACAACTGCAGAGTTTTGGGATGGATGTGACTG
TTCTGGAGTCAAGAGATCGAGTTGGTGGACGAGTGGCCAC
TTTCAGAAAAGGGAACTATGTAGCTGACTTGGGTGCTATG
GTGGTGACTGGCCTGGGTGGAAACCCTATGGCTGTGGTCA
GCAAACAGGTCAATATGGAGCTGGCTAAGATAAAACAGAA
GTGTCCCCTCTATGAGGCCAATGGACAGGCTGGAGAGCGC
TGCACAAGTGTCCCTAAAGAGAAGGATGAGATGGTAGAGC
AAGAGTTTAATCGCCTGTTAGAGGCAACATCATACCTCAG
CCACCAGCTTGACTTCAACTTTCTTAACAACAAACCTGTG
TCTCTGGGACAAGCACTGGAAGTGGTCATACAGCTACAGG
AAAAACATGTGAAAGATGAACAGATCGAACACTGGAAGAA
GATTGTGAAGACTCAAGAAGAGCTCAAAGACCTACTGAAC
AAGATGGTGACTACTAAGGAGAAAGTGAAGGAGCTTCATC
AGCAGTACAAAGAGGCCAGTGAAGTAAAGCCACCCAGAGA
CATCACAGCTGAGTTCCTGGTGAAGAGCAAACACAGAGAC
CTCACAGCACTCTGCAAGGAGTATGATGAGCTGGTGGAGA
TGCAGGTTAAACTAGAGGAGAGACTGCAGGAGCTGGAGGC
CAATCCACCCAGTGATGTGTATCTGTCTTCAAGAGACCGT
CAGATTCTTGACTGGCACTTTGCAAACCTGGAGTTTGCCA
ATGCCACACCGCTGTCAACACTCTCACTCAAACACTGGGA
TCAGGATGATGATTTTGAGTTTACGGGCAGTCATCTGACT
GTGCGGAACGGGTACTCGTGTGTCCCGGTGGCCCTTGCCG
AGGGTTTGGATATCAAACTCAACACTGCAGTAAGACAGGT
CCGATACACATCATCTGGTTGCGAGGTGATTGCGGTGAAT
ACTCGCTCCACTACCCAGACATTCATTTATAAATGTGACG
CCGTGTTGTGTACCCTACCTTTGGGAGTGATGAAACAGCA
GCCGCCGGCCGTGCAGTTTGTCCCTCCTCTGCCAGAATGG
AAGACGGCTGCCATCCAGAGAATGGGCTTTGGAAATCTCA
ACAAGGTGGTGTTGTGTTTTGATAGAGTATTCTGGGATCC
CAGTGTTAACCTCTTTGGCCATGTGGGAAGCACGACAGCC
AGTCGAGGAGAACTGTTTCTCTTCTGGAACCTCTACAAAG
CCCCCATACTGTTAGCTCTGATGGCAGGAGAGGCTGCAGG
CATTATGGAGAATATCAGCGATGATGTCATCGTTGGTCGT
TGTCTGGCCATCCTCAAGGGCATTTTTGGAAGCAGCGCAG
TCCCTCAGCCGAAGGAGACGGTGGTGAGCCGCTGGCGTGC
AGACCCCTGGGCTCGAGGCTCATACTCGTACGTCGCAGCC
GGCTCTTCTGGTAATGACTATGATCTCATGGCTCAGCCTA
TCACACCTGGTCCTGCCATACCTGGAGCCTCACAGCCTGT
TCCACGTCTGTTCTTCGCTGGTGAACACACGATCAGAAAC
TATCCTGCCACAGTACATGGTGCTTTGCTGAGTGGCCTGA
GGGAGGCCGGGAGGATAGCCGATCAGTTCCTGGGAGCCAT
GTACACTATGCCACGCCAGGCCACAGCCAATCCAAACCCA
CAGCCCTCCCCCAGCATCCAATAAACCCAGCACATGGTGC
AGACTGAGAGAAAATAAGATGGGGATTGTCGGAGAAAGAA
TGTCTTGGTTGATAAAGAGCGGGTGGGTCAAGTGAGGACA
CTGGGTGACTCCTTAGACTGAGAATGTGTGTTTATGGGAG
AGTTTGTCTGCGTGTAAGAACATGCCTTTAGGGAAATCAT
TCTCTAATCTGGGAGCTGGAGCTGGGATTTAAATAAACCT
TTTGCTCAGTTTTATTTTTACCTACTATCTAACTTATTGG
TCATCTGAAAGGACAAGTGGATTGTTCCAGTAGAGTTATG
TCGGAATGTTCCTGGAATGGTTTGCTCCATGCTAAGGCAC
ATATAAGCACACAGACTTATTTACACTCCTGCAAAGTCCT
CGTTCACATATCAGATGTTTCAGTGCAGAGCATTAAATTG
TAAAAAATAGGAGATGGACATGGATACATTAGTTGAAATC
CAACTGCCTACCCAACCCATTCCTTTTTATTTTTTCAGAA
TATAATAAAAAAAATAAATAAATAAAATAAAATAAATCAA
AAGCAGATGTTATGCCTTTCTGTGTCCCTCACTTTGTAGC
TTGAATGTTTTTGTTTGGAAAAAAATTCTTATTAGCTGGA
ATGCACGTTGTTGCTAATAGGTCTGTTTCTGTTATAATAG
ATGATCAGTTCTAACTTTGTATGTTTTTGAGCAGTGCAAG
TTTTATTTTTAAGTGTTCTTGTTTAATTATTGCTTTTTTA
TATTTTGTGATTTATTTGATATTAAAAATATGAAATCATC
TTCATAA

kdm1a TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA kdm1a-201 3367
kdm1a-202 (1)    Ensembl 887
kdm1a-203 (1)    Ensembl 500
kdm1a-204 (1)    Ensembl 456
kdm1a-207 (1)    Ensembl 606
ncRNA kdm1a-005 (1)    Ensembl 975
kdm1a-006 (1)    Ensembl 1015
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
kdm1a-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000049897 (1),  Ensembl_Trans:ENSDART00000085758 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC125965 (1) 3352 bp
GenBank:CK141873 (1) 760 bp
GenBank:EB775400 (1) 431 bp
GenBank:CD600395 (1) 310 bp
CITATIONS (2)