Transcript

kdm1a-204

ID
ZDB-TSCRIPT-110325-626
Name
kdm1a-204
Previous Names
  • kdm1a-003
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000049900 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000049900|OTTDARG00000035108|ZDB-GENE-030131-7828 kdm1a|OTTDARP00000039158 kdm1a-003 LG_ AL844186.7 Danio rerio protein_coding KNOWN, 456 bp
AAGAAAGAAAGAGCCTCCCCAAGTGGAGTACAGGGAGATG
GATGAAAGTCTCGCTAATCTTTCGGAGGATGAATATTACT
CTGAGGAGGAGAGGAATGCTAAAGCTGAGAAAGAACGCAA
GCAGGTGATTCCTCCACCAGCACCACCAATAGAGGAGGAG
AATGACAGCGAACCTGAGGAACCATCAGGTGTAGAAGGGG
CCGCCTTCCAGAGCCGTCTCCCACATGACCGTATGACATC
ACAGGAAGCTGCATGCTTCCCTGACATAATTAATGGACCA
CAACATACTCAGAAAGTGTTCTTGTATATTCGAAACCGCA
CACTTCAGCTGTGGTTGGACAACCCCAAAGTCCAGCTCAC
CTTTGAGGCCACAGTGCAGCAGCTAGAAGCTCCATACAAC
AGTGATGCCGTCCTGGTCCACCGGATACACAGCTATTTAG
AGAGACACGGGTTTAT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations