Transcript

kdm1a-207

ID
ZDB-TSCRIPT-110325-1533
Name
kdm1a-207
Previous Names
  • kdm1a-004
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000049898 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000049898|OTTDARG00000035108|ZDB-GENE-030131-7828 kdm1a|OTTDARP00000039156 kdm1a-004 LG_ AL844186.7 Danio rerio protein_coding KNOWN, 606 bp
GTGATGCCGTCCTGGTCCACCGGATACACAGCTATTTAGA
GAGACACGGGTTTATCAACTTTGGCATCTACAAGAGAGTA
AAGCCTCTACCAACAAAGAAGACTGGAAAGGTGATCGTGA
TTGGTGCCGGGGTGTCAGGGCTGGCCGCAGCAAGACAACT
GCAGAGTTTTGGGATGGATGTGACTGTTCTGGAGTCAAGA
GATCGAGTTGGTGGACGAGTGGCCACTTTCAGAAAAGGGA
ACTATGTAGCTGACTTGGGTGCTATGGTGGTGACTGGCCT
GGGTGGAAACCCTATGGCTGTGGTCAGCAAACAGGTCAAT
ATGGAGCTGGCTAAGATAAAACAGAAGTGTCCCCTCTATG
AGGCCAATGGACAGGCTGTCCCTAAAGAGAAGGATGAGAT
GGTAGAGCAAGAGTTTAATCGCCTGTTAGAGGCAACATCA
TACCTCAGCCACCAGCTTGACTTCAACTTTCTTAACAACA
AACCTGTGTCTCTGGGACAAGCACTGGAAGTGGTCATACA
GCTACAGGAAAAACATGTGAAAGATGAACAGATCGAACAC
TGGAAGAAGATTGTGAAGACTCAAGAAGAGCTCAAAGACC
TACTGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations