ZFIN ID: ZDB-TSCRIPT-091203-246
Transcript Name: vwf-003
Previous Names: vwf-004, ottdart00000045300

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000045300 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000045300|OTTDARG00000028871|ZDB-GENE-070103-1 vwf|no_translation CH1073-474E24.1-003 LG_none CU929302.3,CU651594.7,CU651633.15 Danio rerio protein_coding NOVEL, 823 bp
TTTGTGAAAACGTTTATAAAGAGCACAAACATCGGTCGTA
ATGACACGCAGGTGGCGGTGATGGTGTACGGGGCGAAATC
AGCAGTGGCGGTCACATGGAGAGATGAACAGACACAAGAC
AACCTTCTCAAGCTGCTGGAATCTCTACACGGCAAAACAG
ACAACCAGCCACGACTGGGAGCTGCTCTGCGATTGGCCGT
ACAGACAGCAGTTTCCTCCACCAGCGGGGCAAGGATGGGC
ATCCCTAAAGCTGTGGTTATGGTGGTGACGGACAGGTCAA
TAGACTCAGTGCAAGAGGCAGCAAATGAGGCTCTGACTGC
TGGTGTGTCGGTGTTTCCTATTGGTCTGGGTAAGCAGTAT
GATCAGATTGAAGTGAACACACTCGCAGGCCCACAGGCTC
AGGAAAACGTCATTCTGCTCGGCAGCACAGAGTATCTGCT
TTCCATGGCTGCGTTTGACCAGTCCTTCCCTGACAAACTC
TGCAGAGCCCGGTGAGACGTGGATGCTGGCAGACGGCTGT
CACTCAGTGCTGTGCAACCCATCCGGCACAATAACAATGC
AGAGCCACCGTATCAACTGCGAGAAGATGGAGCCTCCCGT
CTGTAAAAACAACCTCCCAGCCCTGCGCTACAATCACCAC
TGCGGTTGTACCTGGACCTGCCCCTGCAGTTGCATGGGCA
GCTCCACTAGCCACGTGGTGTCGTTTTCGGGGGCGGCCCT
AAAGGTGAAATCTGCCTGCTCCTATTTGCTGCTTCGCTCA
GGGGGGGCGGAGCTAGTTTTACATACGACTGCCTGTCAAA
GCTCACCCAATCAGATCTGCATG

vwf TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA vwf-202 (1)    Ensembl 6177
vwf-204 (1)    Ensembl 1332
ncRNA vwf-003 823
vwf-004 (1) 823
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
vwf-003 Contained in:

Genome Resources: Vega_Trans:OTTDART00000045300 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES No data available
CITATIONS (1)