Transcript

vwf-003

ID
ZDB-TSCRIPT-091203-246
Name
vwf-003
Previous Names
  • vwf-004
  • ottdart00000045300
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000045300 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000045300|OTTDARG00000028871|ZDB-GENE-070103-1 vwf|no_translation CH1073-474E24.1-003 LG_none CU929302.3,CU651594.7,CU651633.15 Danio rerio protein_coding NOVEL, 823 bp
TTTGTGAAAACGTTTATAAAGAGCACAAACATCGGTCGTA
ATGACACGCAGGTGGCGGTGATGGTGTACGGGGCGAAATC
AGCAGTGGCGGTCACATGGAGAGATGAACAGACACAAGAC
AACCTTCTCAAGCTGCTGGAATCTCTACACGGCAAAACAG
ACAACCAGCCACGACTGGGAGCTGCTCTGCGATTGGCCGT
ACAGACAGCAGTTTCCTCCACCAGCGGGGCAAGGATGGGC
ATCCCTAAAGCTGTGGTTATGGTGGTGACGGACAGGTCAA
TAGACTCAGTGCAAGAGGCAGCAAATGAGGCTCTGACTGC
TGGTGTGTCGGTGTTTCCTATTGGTCTGGGTAAGCAGTAT
GATCAGATTGAAGTGAACACACTCGCAGGCCCACAGGCTC
AGGAAAACGTCATTCTGCTCGGCAGCACAGAGTATCTGCT
TTCCATGGCTGCGTTTGACCAGTCCTTCCCTGACAAACTC
TGCAGAGCCCGGTGAGACGTGGATGCTGGCAGACGGCTGT
CACTCAGTGCTGTGCAACCCATCCGGCACAATAACAATGC
AGAGCCACCGTATCAACTGCGAGAAGATGGAGCCTCCCGT
CTGTAAAAACAACCTCCCAGCCCTGCGCTACAATCACCAC
TGCGGTTGTACCTGGACCTGCCCCTGCAGTTGCATGGGCA
GCTCCACTAGCCACGTGGTGTCGTTTTCGGGGGCGGCCCT
AAAGGTGAAATCTGCCTGCTCCTATTTGCTGCTTCGCTCA
GGGGGGGCGGAGCTAGTTTTACATACGACTGCCTGTCAAA
GCTCACCCAATCAGATCTGCATG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations