header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-091203-19
Transcript Name: vwf-204
Previous Names: vwf-002, ch1073-474e24.1-001, ottdart00000045298

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000045298 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000045298|OTTDARG00000028871|ZDB-GENE-070103-1 vwf|OTTDARP00000035797 CH1073-474E24.1-002 LG_none CU929302.3,CU651594.7,CU651633.15 Danio rerio protein_coding NOVEL, 1332 bp
CAAAGCCAGTTCACACCCGGTGACATGATGGGTGATGGTT
TATTGAAAGCCAATGGATCAGTGTGCTTGAACACTCCCAC
AGAGGGCTGTTTCTGTCCTGAAGGCTCCGTGTTAATGGAA
GATAAGTGTGTAGACAGAGAGGCCTGCAGTCAGTGTGTGG
AACACAGCGGGAAAACTCACCAGTTCATGGAGAGCTGGAA
TCCTGAGGACAACCCGTGTGTTCTGTGTGTGTGTCTGGAC
CAGCAGCGCATCAACTGCACAGCTCTGCCCTGCACCAATG
CTAAAGCCCCGGAGTGCGGACAATGTGAGGTTCTCCAGGA
GAAGATGGGATCCAAGTGCTGCCCTCAATATGAGTGTGTG
TGTGACATAAACTGCAAACGTCCAGATCCTCCTCACTGTG
ATCACGGACTCAGTGTTGTCCTCACAAACCCAGGAGACTG
TCTGCCAGTTTACCAGTGCGTGTGCAAAAAGGATCAGTGT
CCTGACTCAACAAAACCTTCCTGTCCTGCATACAAGAAGC
TGTCGGTGAAAGCATCCGAGTGCTGCGATTCATACCAATG
TCTGTGCAATTGTCAAAACATCACCCGCACCTGCCCTCCA
GGCTACATCACAAAGACCAGCACCAATGATTGCCAATGCA
CAGAGGTCACCTGCACGCCTGATAAGGTGTGTGTGGTGGA
CGCTGTGGTGTACCAGGTGGGCAGCAGGTGGGAGGAGAAG
TGTAAAACTTGCAGATGCACCGAGCAGACGGACGGACAGA
CCGGCCTGCACATCGCTCAGTGTGTGGACCCCGTCTGCAA
CCAGATCTGCCCTGTGGGAAGCACATACTCTCATTCAGGA
GGCGAGTGTTGCGGTCACTGCCGTAAATCCAGCTGTGAGG
AAGGAGGACTGTTGAGGCAGGTCGGAGAGCAGTGGGTGTC
TGCGAACGACAGATGTGTGTGGAGCGAATGTGTGCAAGTG
AATGAGGAAGTGTTCATCCAGCATACAAACGTGTCCTGCC
ATCACATGGACACGCCGGCCTGTCCGCTGGGCACTGAGCT
CCAGTGCAATACAGTGGACGACTGCTGCCCATCCTGCCAC
TGTGTCCCAATGAATGCCTGCGTGCTGAATCAAACTGTTA
TTGCGGCTGGAGAGCGAGTGATGCTGGATGTGTGCACACA
CTGCGAGTGTGTGGGAGATAAGAGGAGTTATCGGCTCTCT
TGCAGGAAGATGAGCTGCTCCCCCTGCTCAGAGGGATATA
CGATGGAGCCAATACCTAATGCTTGCTGTGGTCGATGCGT
GGCAACCGCATGTAGTGTCCGACGACCTGACGGAGAGCTG
ATCACACTGAAA

vwf TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA vwf-202 (1)    Ensembl 6177
vwf-204 1332
ncRNA vwf-003 (1) 823
vwf-004 (1) 823
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
vwf-204 Contained in:

Genome Resources: Vega_Trans:OTTDART00000045298 (1),  Ensembl_Trans:ENSDART00000142905 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:EB982762 (1) 596 bp
GenBank:EB902243 (1) 561 bp
GenBank:EB978371 (1) 514 bp
CITATIONS (2)