Transcript

vwf-204

ID
ZDB-TSCRIPT-091203-19
Name
vwf-204
Previous Names
  • vwf-002
  • ch1073-474e24.1-001
  • ottdart00000045298
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000045298 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000045298|OTTDARG00000028871|ZDB-GENE-070103-1 vwf|OTTDARP00000035797 CH1073-474E24.1-002 LG_none CU929302.3,CU651594.7,CU651633.15 Danio rerio protein_coding NOVEL, 1332 bp
CAAAGCCAGTTCACACCCGGTGACATGATGGGTGATGGTT
TATTGAAAGCCAATGGATCAGTGTGCTTGAACACTCCCAC
AGAGGGCTGTTTCTGTCCTGAAGGCTCCGTGTTAATGGAA
GATAAGTGTGTAGACAGAGAGGCCTGCAGTCAGTGTGTGG
AACACAGCGGGAAAACTCACCAGTTCATGGAGAGCTGGAA
TCCTGAGGACAACCCGTGTGTTCTGTGTGTGTGTCTGGAC
CAGCAGCGCATCAACTGCACAGCTCTGCCCTGCACCAATG
CTAAAGCCCCGGAGTGCGGACAATGTGAGGTTCTCCAGGA
GAAGATGGGATCCAAGTGCTGCCCTCAATATGAGTGTGTG
TGTGACATAAACTGCAAACGTCCAGATCCTCCTCACTGTG
ATCACGGACTCAGTGTTGTCCTCACAAACCCAGGAGACTG
TCTGCCAGTTTACCAGTGCGTGTGCAAAAAGGATCAGTGT
CCTGACTCAACAAAACCTTCCTGTCCTGCATACAAGAAGC
TGTCGGTGAAAGCATCCGAGTGCTGCGATTCATACCAATG
TCTGTGCAATTGTCAAAACATCACCCGCACCTGCCCTCCA
GGCTACATCACAAAGACCAGCACCAATGATTGCCAATGCA
CAGAGGTCACCTGCACGCCTGATAAGGTGTGTGTGGTGGA
CGCTGTGGTGTACCAGGTGGGCAGCAGGTGGGAGGAGAAG
TGTAAAACTTGCAGATGCACCGAGCAGACGGACGGACAGA
CCGGCCTGCACATCGCTCAGTGTGTGGACCCCGTCTGCAA
CCAGATCTGCCCTGTGGGAAGCACATACTCTCATTCAGGA
GGCGAGTGTTGCGGTCACTGCCGTAAATCCAGCTGTGAGG
AAGGAGGACTGTTGAGGCAGGTCGGAGAGCAGTGGGTGTC
TGCGAACGACAGATGTGTGTGGAGCGAATGTGTGCAAGTG
AATGAGGAAGTGTTCATCCAGCATACAAACGTGTCCTGCC
ATCACATGGACACGCCGGCCTGTCCGCTGGGCACTGAGCT
CCAGTGCAATACAGTGGACGACTGCTGCCCATCCTGCCAC
TGTGTCCCAATGAATGCCTGCGTGCTGAATCAAACTGTTA
TTGCGGCTGGAGAGCGAGTGATGCTGGATGTGTGCACACA
CTGCGAGTGTGTGGGAGATAAGAGGAGTTATCGGCTCTCT
TGCAGGAAGATGAGCTGCTCCCCCTGCTCAGAGGGATATA
CGATGGAGCCAATACCTAATGCTTGCTGTGGTCGATGCGT
GGCAACCGCATGTAGTGTCCGACGACCTGACGGAGAGCTG
ATCACACTGAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations