Transcript

vwf-202

ID
ZDB-TSCRIPT-090929-19802
Name
vwf-202
Previous Names
  • vwf-001
  • ottdart00000039513
  • si:ch1073-474e24.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000039513 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000039513|OTTDARG00000028871|ZDB-GENE-070103-1 vwf|OTTDARP00000031608 CH1073-474E24.1-001 LG_none CU929302.3,CU651594.7,CU651633.15 Danio rerio protein_coding NOVEL, 6177 bp
CTACCTGTTTGTCCTGCAGATTTGCTGTTGGTCGAGGGCT
CGGCTCGCTGTAGTCTGTTTAGTCGGCAGCACATACACAC
ATTTGACGGTGTGATTTATGAATTCCCTGGCGACTGCAGC
TACATGCTGGCGGGAGATTGCAGGCAGCGAAGCTTCTCCA
TACTGGGTGATTTCTCTCATGGAAAGAGGAAAGGAGTGAC
TGTGTTTCTGGGAGAAATGTTTGAGCTGCACCTCTCTGTG
GATGGAACGCTGTCACAAGGAGCAGAGAGGCTCCCGCTGC
CGTATGCATCAAGCTCTGTGTTTGCAGGGTATGAACTGGG
CTACGTTCGATTATGGAGCGAAGAGTTTGGATTCTCCATC
CGTATAGATCCCTTACATAACATTCAACTAACGCTGGAGA
AACGTCACAGCAACCAAACATGTGGCCTCTGTGGGAACTA
CAACTATCTTGCTGAGGACGAGTACAGCGCACAAGAAGGT
TTTTTGACAGATGATCCTTACGACTTTGCGAACTCATGGG
CCATGAAAGGAGCAGATGAACCCTGTAAACGTGTGCTTCC
ACCATCTCAAAGCTGCAACAGCACTGGAGAATCAACCAAA
ATGTCTGCATGTGAGTCTATGCGCAGCTCTGTACTCTTCA
TGCACTGTGCTCATCTGGTGGATCCAGCTGCGTTTGTGTC
CGTCTGTGAGTCTGATGTGTGCCACTGCAGTGCCGGAAAG
GAGTGTGTGTGTCAGGCCATGCTGGAATACAGCCGAGCCT
GTGCCAGTCGAGGCATTACACTGTCCAACTGGCACACACA
GAGCCAGTGCTCCCCTAAGTGTCCTGTTGGCATGGAGTAC
AGCGACTGCACCCCGACCTGCTCCACTTCCTGTCAGAATG
TGAACATACAGGAGGTCTGCAAAGAGGAGTGTGTCGACGG
CTGCATCTGCCCAGCGGGGAAGGTGCTGGATGGCGATCGC
TGTGTTGACGTGTCTCAGTGCTCCTGCACGCATGCGGGAC
GGCGATACCCTCCTGCCTCCTACATATCTCAGGACTGCAA
CACATGCGTCTGTCGGCATGGATCATGGGAATGCACTAAT
GAAGGATGTCCTGGTGAGTGTTTGGTGACAGGACAGTCGC
ATTATAAGACCTTTGACAACAAATTCTTCACCTTCAGTGG
GATTTGTCACTATCTGCTTGCTAAAGACTGCCAGAGCAAC
TCTTTTTCTGCCGTCATTGAGACTGCACAGTGTGCTGATG
ATCAAGATGCCATCTGCACACGCTCAATAACACTGAGGTT
CAAGGATCTGGCCAATCAGACGGTTCACCTTAAACATGGG
GGAGTGGTCTCTGTTGATGGAATGGATGTGCAAACACCCT
TAATTAATGGTCCCCTGAGAATCCAGAATACCGTGTTGTC
ATCTGTGAGACTGCGTTATGGACATGATTTACATCTGGAT
TGGGACGGCAGAGGACGTGTTTTGCTCAGGCTAAAACCAG
CCTATGCTGGGCAAATGTGCGGCTTGTGTGGTAATTACAA
TGGTAACCAGGGAGACGACTTCTTAACAGTGGGCGGGCTG
GTGGAGACACGCGTGGAGGCATTCGGCAACTCGTGGAAGA
TGAACGCAGACTGTGATGATGTGCAGATGCAAAACTCTGA
TCCCTGCAGCTTAAACCCAAAGAGAGTGCGTTTTGCAGAA
GAGGCCTGTGCTGTGCTGCTCTCCATGAAGTTCGAACCCT
GTCATTATATGGTGAACCCTGAGCCGTATGTGAAGAACTG
CCGCTATGATGTGTGCGCATGCGCAGATGGTCAGGAGTGT
CTGTGTGACGCTGTGAGCAGTTATGCAGTCGCGTGCGCAG
CCAGAGGAGTGCTGGTCAACTGGAGGAGTCACGGATACTG
TGAACTGACCTGTCCGGATGCGCAGGTGTATGAGATGTGT
GGCAGTGTGTGTAACCAGACGTGCCGCTCTCTGTCTCTGC
CGGACACTGGTTGTGACGGTGTGTGTGAGGAAGGCTGTTT
CTGCCCCAGAGGACTGTTTCTCAGTGACGCGGGCGAGTGT
GTGCCTCCACAGCACTGCTCCTGCCACCATAACGGAGAGA
TCTTTGAGCCCAATGACATGATCGGGGACCATCACTCCAT
CTGTGTATGTGAGAGCGGATCCATGCACTGCACATCTAAT
GAAGCCACCGGATCTACTCTGTCTGACCTCTTCTTTGATG
AACAATCTCCATCGAGAGGGCGGCGCTCACTCTCCTGCCC
TCCTCCACTGCAGCGCTTTGAGTGTGAAAGTGCAAGAGAT
GCTGGGATTGAGTGTGCAAAGACGTGCCAGAATCTGGAGC
TGGATTGTGTCAGTCTGGGCTGTGTGTCTGGATGCATGTG
TCCACCTGGAACAGTTCGATACAGAAAAGACTGCATTCCC
CAAGAGCAGTGTCCTTGTTATCATAACAGCAGGCCTTACG
AGTCAGGACAAAGCATCACTGTGGACTGCAACACCTGTGT
GTGTGAGCAGCGTCAGTGGAAATGTTCAGAGCGAGTGTGT
GACGGTGTGTGTCGTGCTATTGGAGACACACACTACATCA
GCTTTGACGGACTCAAATTCTCCTTCCCTGGACCCTGTCA
GTATGTGCTCGCTCAGGATTACTGTAATGGTCTTGATGGG
ACATTCCGGGTTCTGGTGGAGAACTCGGCGTGTGGCATCG
CAGGTTATCGTTGCAGTAAAAGCATCACAGTGCTGTACAT
GGGAGGACTGATTGTCATGGAGCACGGAGAGGTGAGGATG
AAGAGGCCTGTGCTGAAGGAGACGGAGGTTGAGATTGTGA
GATCTGGACTGTATTATATTGTTCTGCTCGGCAAACACAT
CTCAATTACATGGGACACGGGAACCCGAATCTCCCTGCAG
ATCAGCGGACAGTACAGGGGGAAAGTGTGTGGTCTTTGTG
GGAATTTCGACGGCAGTCAGAATAATGACCTGTTGAGCAG
CAGTAATCAGATGGAGGTGGACGCTGCTGACTTTGGAAAC
TCGTGGAAAGTTCGACCCAGTTGTGCTGACGCTGTTTCAG
TGGTGTCCCAGTGCAGCACAGACCTGGTAAAGTTGGTGAC
GGTGGAGCAATCCTGCCGTGTACTCACCAGCGCCATCTTC
AGGGACTGCAACAGTGTGGTGGACCCGGAGCCGTACTGGG
ACATCTGCACTCAAGACACCTGCTCATGCCCGTCTGTTGG
GGACTGTGCCTGTTTCTGTAACACTATCGCCGCTTATGCT
CACGAATGTGCTCAGAAGGGGCTGCCGGTCAACTGGAGGT
CCAACGACTTGTGCCCTCTGAGCTGTGAGGATCTGAATAA
GGAGTCTGGGGTTCAGTGTGAGTGGAGATATAACACCTGT
GCTAGCGCCTGCCCATCCACCTGCCAGCACCCGGAGCCTC
TGAGCTGCCCCATCAGCTGTGTGGAGGGATGCCATGCTGT
CTGTCCGCCAGGGCACCTTTTAGACGAGGTGCTGAGAAAG
TGTGTGGAGCCATCTCAGTGTCAGGTGTGTGTTCACGATG
GACAGAGAGTCTCGCATGGAAAACAGTTCATCCTCAACCA
TGAAGATCCACGTCTCTGCCAGATATGCCACTGTGAGAGC
AACACACTAACATGTGGGCCATGTCCAGTAACTGGTTTAA
CCTCCACACTGGCACCAACCACCGTCACTCCCACTCCACT
GCCGTTCTCCACCCCGGTGCCTGCGGATGCCTGCGATCGA
GCCATGGACCTGGCCTTCCTGGTGGACGGATCTTCAGCTC
TGAGCGAAGACGACTTCAGCATGATCAAACTCTTCATCCT
CAGAGTGGTGGAGCGTTTCCGCATGGGCTCGGCTCACACT
CGCGCCACAGTCCTCCTCTTCCACTCTGGGGTGAAAAGTT
ACGACATGCAAGTGCAGAAGTGGATCTTCAAGAAGATGGT
GCGCGAGATGCGGTACACCGGTGGTGATGTCGCATTCATG
GATGAAGCCATAAAATATCTTGCAGTCTACATTTATGATA
AAAACAAGCGTGAGCATGCGGGACGTGTTGCGATTCTGTT
GACGGCAAGTGCTAATCCTCGGCCCATGCGCAGTACTCAA
CGTCTGCTGCGTAAGAAGGACATCACCATCCTCACAGTGG
CACTCGGGCCTGATGTTAACATGGCGCAGGTCAACGAGAT
CACGAAAGCCACACCGAGCAGTCGTGCCTACGTAGTGAGC
AGCGTAACAGAGCTGGACGATGAAGCTTTGAGCATTACTG
ACTACCTTTGTACTTTGGGATTAGATCCTGAACCTCAGAA
GAAACCTCCTACAGCAAAACCCAGCACTACTTCAGTTACT
CCAACAACTAACGCCATTACTAAACTTACTATTCCTCCAA
CCGCTGCTATTGTAACTGCATTTCCCAGCATTCCCACTCC
TGGAACGACACTCGTTCCAACCACGGTCACAACCTACGAT
CTTGTGTTCCTCTTGGAAAACGCAAACGCTACAGGCGAGG
ACGGCTTCAATAAGACGCGTGATTCTTTGATTAACATCAT
CACATCACTTGATCAGAAAGAGGCAGAGAATCTACGCATT
ACGGTGATGATGTACTCGGTCACCGTTACTGTGGAAATCA
GTCGCATGGAGCTGCATCACAGAGAACAGGTGGTGCAGCG
AATGCGACAGTTGCGTTGGACCGAAGGCGCAGAGGTCAAC
ACAGGTCACGCCGTTCAGTCTGTATACGAGACGATCACCA
CAGACACACACAGTGATACTCCAGACCAGCTGGTGTTTCT
CATAACACAGAGTCCTCCAACTGACGTCATTCAGCGGCCT
CCGAGCTCCACTCATAAGAAGATCTATCCGATCGGGATCG
GCCGAAAAATTCGATATGAGGATCTCGCACTGTTGAGCTT
TCCGGATAAGCCAATCATGCTGGATGACCCTTCTGACCTC
AGGACACTGCAGCCCATGTTGATCAATATCAGTAGGACGG
TCAGAAGGCCACTGCTGCCAACACTGCCACCCAGAGCCAC
ACTGCCCCCTTCAGTGCCGTGTTCAAAACCCATGGACGTG
TTGTTCCTGCTGAGAGCGTCTTCAGGAAGCCAGTTTGAGG
ACTTGAAAACATTTGTGAAAACGTTTATAAAGAGCACAAA
CATCGGTCGTAATGACACGCAGGTGGCGGTGATGGTGTAC
GGGGCGAAATCAGCAGTGGCGGTCACATGGAGAGATGAAC
AGACACAAGACAACCTTCTCAAGCTGCTGGAATCTCTACA
CGGCAAAACAGACAACCAGCCACGACTGGGAGCTGCTCTG
CGATTGGCCGTACAGACAGCAGTTTCCTCCACCAGCGGGG
CAAGGATGGGCATCCCTAAAGCTGTGGTTATGGTGGTGAC
GGACAGGTCAATAGACTCAGTGCAAGAGGCAGCAAATGAG
GCTCTGACTGCTGGTGTGTCGGTGTTTCCTATTGGTCTGG
GTAAGCAGTATGATCAGATTGAAGTGAACACACTCGCAGG
CCCACAGGCTCAGGAAAACGTCATTCTGCTCGGCAGCACA
GAGTATCTGCTTTCCATGGCTGCGTTTGACCAGTCCTTCC
CTGACAAACTCTGCAGAGCGGGTCCTCCCGGAGTGTGTGT
GGATGATGAAGGGAATGAAAGAAAGCCCGGTGAGACGTGG
ATGCTGGCAGACGGCTGTCACTCAGTGCTGTGCAACCCAT
CCGGCACAATAACAATGCAGAGCCACCGTATCAACTGCGA
GAAGATGGAGCCTCCCGTCTGTAAAAACAACCTCCCAGCC
CTGCGCTACAATCACCACTGCGGTTGTACCTGGACCTGCC
CCTGCAGTTGCATGGGCAGCTCCACTAGCCACGTGGTGTC
GTTTTCGGGGGCGGCCCTAAAGGTGAAATCTGCCTGCTCC
TATTTGCTGCTTCGCTCAGGGGGGGCGGAGCTAGTTTTAC
ATACGACTGCCTGTCAAAGCTCACCCAATCAGATCTGCAT
GAAGAGCCTGGAGCTGAGGGAAGGCGGGACCAGTGTGGTG
CTTCAGGATGACATGAAGGTGACTGTGGGCGGTGTTTTGA
CTGCAGTCCCGTTCAGAACTGAGCGAGTGACTGTGACACA
AATTGGCTCCATCCTTCACCAGCTGAGATCTGAGCAGCAC
GGCTTCACACTCACCTTCACTCCTCACAGCAATGAGTTCA
TGCTCAATATGGACATC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations