ZFIN ID: ZDB-TSCRIPT-091203-132
Transcript Name: vwf-004
Previous Names: vwf-003, ch1073-474e24.1-002, ottdart00000045299

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000045299 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000045299|OTTDARG00000028871|ZDB-GENE-070103-1 vwf|no_translation CH1073-474E24.1-004 LG_none CU929302.3,CU651594.7,CU651633.15 Danio rerio protein_coding NOVEL, 823 bp
ATCTTCGTTTTCTGAAGAAACCGATATGCTAACCGATATA
TAAAAACACAGTTTGAGTAAATTTAAATGTAAAAAATTGT
GTGACATAAACTGCAAACGTCCAGATCCTCCTCACTGTGA
TCACGGACTCAGTGTTGTCCTCACAAACCCAGGAGACTGT
CTGCCAGTTTACCAGTGCGTGTGCAAAAAGGATCAGTGTC
CTGACTCAACAAAACCTTCCTGTCCTGCATACAAGAAGCT
GTCGGTGAAAGCATCCGAGTGCTGCGATTCATACCAATGT
CTGTGCAATTGTCAAAACATCACCCGCACCTGCCCTCCAG
GCTACATCACAAAGACCAGCACCAATGATTGCCAATGCAC
AGAGGTCACCTGCACGCCTGATAAGGTGTGTGTGGTGGAC
GCTGTGGTGTACCAGGTGGGCAGCAGGTGGGAGGAGAAGT
GTAAAACTTGCAGATGCACCGAGCAGACGGACGGACAGAC
CGGCCTGCACATCGCTCAGTGTGTGGACCCCGTCTGCAAC
CAGATCTGCCCTGTGGGAAGCACATACTCTCATTCAGGAG
GCGAGTGTTGCGGTCACTGCCGTAAATCCAGCTGTGAGGA
AGGAGGACTGTTGAGGCAGGTCGGAGAGCAGTGGGTGTCT
GCGAACGACAGATGTGTGTGGAGCGAATGTGTGCAAGTGA
ATGAGGAAGTGTTCATCCAGCATACAAACGTGTCCTGCCA
TCACATGGACACGCCGGCCTGTCCGCTGGGCACTGAGCTC
CAGTGCAATACAGTGGACGACTGCTGCCCATCCTGCCACT
GTGGTACAGCCTCAATTTCACAC

vwf TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA vwf-202 (1)    Ensembl 6177
vwf-204 (1)    Ensembl 1332
ncRNA vwf-003 (1) 823
vwf-004 823
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
vwf-004 Contained in:

Genome Resources: Vega_Trans:OTTDART00000045299 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:EH543632 (1) 846 bp
CITATIONS (1)