ZFIN ID: ZDB-TSCRIPT-090929-9408
Transcript Name: rbmx-005
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000026793 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000026793|OTTDARG00000021163|ZDB-GENE-030131-579 rbmx|no_translation rbmx-005 LG_ AL929434.3 Danio rerio protein_coding KNOWN, 721 bp
TCAAATGCAGTCTGAAACTCAATGTTATTTTCTACATTTA
TTAGCAAAAGCCCCTGCCTTCAAAGGAGTCTAAGATCTCT
TCCCAACTTCTGGATCACTGAGTTTAGGAGGCCTTTGTCT
CTCAAAAATCAGCCGGTTCTACTGTTGCACTAAAGGAGAA
TGTCTGGATTTTTTTTCACCCCCTTTCAAATGAAAAAAAA
ATGTTTTTAAGTGATATTAAGATGAATCTCCTCAGTGGAT
CTATACCTACAACCAAATGTAAGCTGCAGAACCTCTTGAA
ACCTCTCAGTGGAAAAATATAGAAAATTCACTTAGTGTTA
ACAAAAATCCAAAACCACTCGCAAGCATGCTGAATCTAAC
AAAGGAGACCACCTGGAGAAAGACAACCCCATCAACAAAC
CTGGAAAAAAAACATTCAGATTGGGTCATTGAGTTCTTTT
TTTGTCAAATTTAATTATAAATAATGTCCCTTATGATGAG
CTACAACAGCTTTCTGATTGCAAGTCTCTTTTTCCAGGAT
AAATGGAGGAAAAACTGCTTTGACGGTAATACTTCATTGC
TGAGCAGTACCAACTGTCAATTATGGATGAAGCAGGATGG
TCCATGGTGTCATGCAGACCATCTTTCGGAGGCTGCTGTT
CCTTGAGGCTGAAAGCATTTGGATGGAGTCACGCTATGCT
ACAATTTCTCTTCTTTTTCCCAATAAAATCATTTTAAGTA
A

rbmx TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA rbmx-003 (1) 1094
rbmx-005 721
mRNA rbmx-201 (1) 882
rbmx-202 (1) 1560
rbmx-203 (1) 888
aberrant processed transcript rbmx-204 (1) 1145
mRNA rbmx-207 (1) 386
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
rbmx-005 Contained in:
OTHER rbmx-005 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000026793 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CT727043 (1) 735bp
    GenBank:CT699108 (1) 729bp
    GenBank:CO351177 (1) 490bp
    GenBank:CO354232 (1) 480bp
    CITATIONS (1)