ZFIN ID: ZDB-TSCRIPT-160112-833
Transcript Name: rbmx-201
Previous Name: rbmx-006

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000062873 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000062873|OTTDARG00000021163| rbmx|OTTDARP00000049157 rbmx-006 LG_ AL929434.3 Danio rerio protein_coding KNOWN, 882 bp
CATATAAACCAGCACACGCTTTTGTCTTGTCTATTGATTC
TGAGTGGCATTAACGTTACTGGAAAAAAATGGCAGAGGCA
GACCGACCTGGGAAGCTCTTCATCGGTGGCCTGAACACTG
AAACTAGTGAGAAAGTCCTCGAAGCCTATTTCAGCAAATT
CGGCAGAATATCGGAAGTTCTGTTGATGAAAGATCGTGAA
ACGAACAAATCTAGAGGTTTTGCGTTTGTAACTTATGAAA
ATCCTGGTGATGCTAAGGATGCTGCCAGAGAAATGAATGG
AAAGCCTCTTGATGGAAAGCCAATTAAAGTGGAGCAAGCC
ACAAAACCTCAGTTTGAGACTTCAGGACGCCGTGGGCCAC
CACCACCTCGCAGTCGTGGCCCTTCTAGAGGGCTGCGAGG
GTCCAGAGGAGGCCCAAGTGGAATGCGGGGCCCACCAAGC
AGAGGCATGTCGTCCAGAGGGCCACCACCAATGAAAAGAG
GCCCCCCAGAGCGAAACGGAGGACCCCCACCCAAGAGATC
TGCACCTTCTGGGCCAATGGGCAGACCGTCCAGAGACCGG
GATCCATATGGCCCCCCTCCACGCAGAGATTCTCTTATGT
CACGGCGGGATGATGGTCCTCCACATCGAGATGACCACTA
TGGTAGTAAAGACAGTTATTCCAGCCGTGACTACATGAGC
TCACGGGACAGCAGAGACTATGGCCCACCTCCACGAGATT
ATCCATACCGGGAGTATTCAGGCCATTCCAGTTCCAGAGA
TGACTATGGGTCAGGATCAAGAGGCTATAGTGATCGTGAT
GGCTATGGTGGAGGACGAGAGCCCCGGGGTTATATAGATC
GACCCAGTGCAGGCTCCTATAGAGATCCTTATGATGGTTA
CG

rbmx TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA rbmx-003 (1) 1094
rbmx-005 (1) 721
mRNA rbmx-201 882
rbmx-202 (1) 1560
rbmx-203 (1) 888
aberrant processed transcript rbmx-204 (1) 1145
mRNA rbmx-207 (1) 386
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
rbmx-201 Contained in:
OTHER rbmx-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000062873 (1)
  • Ensembl_Trans:ENSDART00000007927 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EV759002 (1) 965bp
    GenBank:CD753012 (1) 880bp
    GenBank:DN767194 (1) 861bp
    GenBank:CT702353 (1) 839bp
    CITATIONS (2)