ZFIN ID: ZDB-TSCRIPT-090929-9405
Transcript Name: rbmx-204
Previous Name: rbmx-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: aberrant processed transcript
Annotation Status: nonsense mediated decay
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000026790 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000026790|OTTDARG00000021163|ZDB-GENE-030131-579 rbmx|OTTDARP00000038262 rbmx-002 LG_ AL929434.3 Danio rerio protein_coding KNOWN, 1145 bp
GTCGAGTAAGTGACTGTGTTGGGCGGGTCGAGACACAGCG
GACACATATAAACCAGCACACGCTTTTGTCTTGTCTATTG
ATTCTGAGTGGCATTAACGTTACTGGAAAAAAATGGCAGA
GGCAGACCGACCTGGGAAGCTCTTCATCGGTGGCCTGAAC
ACTGAAACTAGTGAGAAAGTCCTCGAAGCCTATTTCAGCA
AATTCGGCAGAATATCGGAAGTTCTGTTGATGAAAGATCG
TGAAACGAACAAATCTAGAGGTTTTGCGTTTGTAACTTAT
GAAAATCCTGGTGATGCTAAGGATGCTGCCAGAGAAATGA
ATGGAAAGCCTCTTGATGGAAAGCCAATTAAAGTGGAGCA
AGCCACAAAACCTCAGTTTGAGACTTCAGGACGCCGTGGG
CCACCACCACCTCGCAGTCGTGGCCCTTCTAGAGGGCTGC
GAGGGTCCAGAGGAGGCCCAAGTGGAATGCGGGGCCCACC
AAGCAGAGAACCCTTTTTTAAAGGCATGTCGTCCAGAGGG
CCACCACCAATGAAAAGAGGCCCCCCAGAGCGAAACGGAG
GACCCCCACCCAAGAGATCTGCACCTTCTGGGCCAATGGG
CAGACCGTCCAGAGACCGGGATCCATATGGCCCCCCTCCA
CGCAGAGATTCTCTTATGTCACGGCGGGATGATGGTCCTC
CACATCGAGATGACCACTATGGTAGTAAAGACAGTTATTC
CAGCCGTGACTACATGAGCTCACGGGACAGCAGAGACTAT
GGCCCACCTCCACGAGATTATCCATACCGGGAGTATTCAG
GCCATTCCAGTTCCAGAGATGACTATGGGTCAGGATCAAG
AGGCTATAGTGATCGTGATGGCTATGGTGGAGGACGAGAG
CCCCGGGGTTATATAGATCGACCCAGTGCAGGCTCCTATA
GAGATCCTTATGATGGTTACGGATAAATGGAGGAAAAACT
GCTTTGACGGTAATACTTCATTGCTGAGCAGTACCAACTG
TCAATTATGGATGAAGCAGGATGGTCCATGGTGTCATGCA
GACCATCTTTCGGAGGCTGCTGTTCCTTGAGGCTGAAAGC
ATTTGGATGGAGTCACGCTATGCTACAATTTCTCTTCTTT
TTCCCAATAAAATCATTTTAAGTAA

rbmx TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA rbmx-003 (1) 1094
rbmx-005 (1) 721
mRNA rbmx-201 (1) 882
rbmx-202 (1) 1560
rbmx-203 (1) 888
aberrant processed transcript rbmx-204 1145
mRNA rbmx-207 (1) 386
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
rbmx-204 Contained in:
OTHER rbmx-204 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000026790 (1)
  • Ensembl_Trans:ENSDART00000138084 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AY394938 (1) 1161bp
    CITATIONS (2)