header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-9406
Transcript Name: rbmx-003
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000026791 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000026791|OTTDARG00000021163|ZDB-GENE-030131-579 rbmx|no_translation rbmx-003 LG_ AL929434.3 Danio rerio protein_coding KNOWN, 1094 bp
AAGCCACAAAACCTCAGTTTGAGACTTCAGGACGCCGTGG
GCCACCACCACCTCGCAGTCGTGGCCCTTCTAGAGGGCTG
CGAGGGTCCAGAGGAGGCCCAAGTGGAATGCGGGGCCCAC
CAAGCAGAGAACCCTTTTTTAAAGGCATGTCGTCCAGAGG
GCCACCACCAATGAAAAGAGGCCCCCCAGAGCGAAACGGA
GGACCCCCACCCAAGAGATCTGCACCTTCTGGGCCAATGG
GCAGACCGTCCAGAGACCGGGATCCATATGGCCCCCCTCC
ACGCAGAGATTCTCTTATGTCACGGCGGGATGATGGTCCT
CCACATCGAGATGACCACTATGGTAGTAAAGACAGTTATT
CCAGCCGTGACTACATGAGCTCACGGGACAGCAGAGACTA
TGGCCCACCTCCACGAGATTATCCATACCGGGAGTATTCA
GGCCATTCCAGTTCCAGAGATGACTATGGGTCAGGATCAA
GAGGCTATAGTGATCGTGATGGCTATGGTGGAGGACGAGA
GCCCCGGGGTTATATAGATCGACCCAGTGCAGGCTCCTAT
AGAGATCCTTATGATGGTTACGGTAAGATTAAACCTGTAA
TGTAGTGAAAATGGTTTGAAGGGCTTTATTCAAACTGCCT
GATTTGCAAAAAGAGCAGCCTCGTGATTTTGCCAGAAAGT
GGAAAACTCAAACTCTGCGTCTGTTCAACCTGAATGTTCC
AACCAAAATCGCACCACCAAGGAATCTCTTGCAAGCCGTT
TTTACCACCCAAAGAGTCTTTTCTGTAGCATCGTCCAAAC
AATCGAGAGATCCAGTACCCAAACTACAATCTGGAGTTCA
ATCCAAACCAAGGAAAGTGTGTTACACTCCAGTGAGGTGC
TTAAAAAAAAAAAAAAAAAACTGTGCGCAAATGTCAACTC
TGCAGTTGGGTATTTCAGTTATCTTAAAGTAGTTCCACCT
AAAAATACAAACAAAAAACTAATTTATTGCTTTTTGCTTT
TGGAAACATTTGATCTACAAATGATTAAAGAAATCTAGGG
AAATGGGCAATTGACAACATAGTATCATGCAAAAAAATGT
TTAAGTAAATTTTT

rbmx TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA rbmx-003 1094
rbmx-005 (1) 721
mRNA rbmx-201 (1) 882
rbmx-202 (1) 1560
rbmx-203 (1) 888
aberrant processed transcript rbmx-204 (1) 1145
mRNA rbmx-207 (1) 386
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
rbmx-003 Contained in:
OTHER rbmx-003 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000026791 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CT655708 (1) 796bp
    GenBank:CT669219 (1) 671bp
    GenBank:CR928872 (1) 539bp
    GenBank:CD584452 (1) 316bp
    CITATIONS (1)