Transcript

sparc-006

ID
ZDB-TSCRIPT-090929-9139
Name
sparc-006
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000026465 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000026465|OTTDARG00000020966|ZDB-GENE-030131-9 sparc|no_translation sparc-006 LG_ BX640507.8 Danio rerio protein_coding KNOWN, 726 bp
CGCTGTACAGTTGATGGGATGAGTCGGGAGTGAAGGGCTC
AGATGGAGCTCCTGCTGTGTCGTTGTCTCATCGCTAAGCA
GGGTGTCTCAGTCAGAAACTCGCTAAATGTGTTTCTGGCG
TAAACGAATTAAGCCCTAACAGCTATTACACTAATATTAG
CCAGAGGGCTGTAATTTGCCCCCTTTTAGGCTATAATACT
ACGGTATATGTCAGCACAGGAGGAGCACTGGCATGCTGTT
TGTGTTTATTATTTGTTTGAAATGGATTGCTTTATTGTGT
GTACTTTTGTTTAGACATCGCTCCCTGCTTGGAGAATGAG
CTGAATGAGTTCCCCCTGCGCATGAGAGACTGGCTGAAGA
ACGTGCTGGTGACTTTGTATGAGCGTGATGAGGACAACAA
CCTGCTCACCGAGAAGCAGAAACTCAGGGTGAAGAAGATT
TACGAGAATGAGAAGAGGCTTCAGGCTGGTGATCACTCTC
TGGACCTTTTGGCCCTGGACTTTGAAAAGAACTACAACAT
GTACATCTTCCCCGTTCACTGGCAGTTTGGCCAGCTTGAC
CAGCACCCTATTGATGGGTTCCTGTCCCACACTGAGCTGG
CCCCTCTGCGTGCTCCTCTTATCCCAATGGAGCACTGCAC
CACCAGCTTCTTTGAGCAGTGCGATGCTGACCAAGACAAG
TACATCGCTCTGGAGGAGTGGGCAAACTGCTTCGGGATCA
AAGAGC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations