header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-9134
Transcript Name: sparc-201
Previous Name: sparc-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000026460 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000026460|OTTDARG00000020966|ZDB-GENE-030131-9 sparc|OTTDARP00000021703 sparc-001 LG_ BX640507.8 Danio rerio protein_coding KNOWN, 1724 bp
ACAGCAAATGTCTTCTGTGTGAACTTGTGCTGCTTTCAGA
AAGTTCTCTCAGAAAGTTTCACCAGCTGACTTCTCCTCTG
GCTTCTCTGTAAGACGGACAGAAGGCTGAAACTCAAGATG
AGGGTTTGGATCTTCTTCCTGTTCTGCCTCGCTGGCAAGA
CTCTGGCAGCTCCAACTGAAGAGGAGCCAGCTGTTGAAGA
GGAGCTGGAAGTGGGAATAAACCCAGTCCAGGTGGAGACC
GGAGAGTTTGATGAAGCCATTGAGGTCGTGGAGGATGTTA
TTGCTGAGAACCCCTGCCTAAACCATCACTGCAAGAAGGG
CAAAGTGTGTGAGGTAGATGACAGCAACCAGCCCATGTGT
GTGTGCCAGGACCCTTTGACCTGCCCCGCTCCAATCGGAG
ACTTCGAGCATGTCTGCGGCACTAACAACAAGACCTACGA
GTCCTCCTGCCACTTCTTTGCCACCAAATGCTCTCTGGAG
GGCACCAAGAAGGGCCACAAGCTGCACATGGATTACATCG
GACCCTGCAAATACATCGCTCCCTGCTTGGAGAATGAGCT
GAATGAGTTCCCCCTGCGCATGAGAGACTGGCTGAAGAAC
GTGCTGGTGACTTTGTATGAGCGTGATGAGGACAACAACC
TGCTCACCGAGAAGCAGAAACTCAGGGTGAAGAAGATTTA
CGAGAATGAGAAGAGGCTTCAGGCTGGTGATCACTCTCTG
GACCTTTTGGCCCTGGACTTTGAAAAGAACTACAACATGT
ACATCTTCCCCGTTCACTGGCAGTTTGGCCAGCTTGACCA
GCACCCTATTGATGGGTTCCTGTCCCACACTGAGCTGGCC
CCTCTGCGTGCTCCTCTTATCCCAATGGAGCACTGCACCA
CCAGCTTCTTTGAGCAGTGCGATGCTGACCAAGACAAGTA
CATCGCTCTGGAGGAGTGGGCAAACTGCTTCGGGATCAAA
GAGCAGGATGTCGACAAAGACCTTGTCATCTAAGGACGTC
TTCCATTGATGCTTCCTAGTTATTATTGGGGGGAGGTGCT
AACCCTTAAGTTAAAATCAAAGTAAAGGTGCTAATTGCGA
TTTCTAACAAGCTGCATATACCACTAAACATTCAAAATGT
TTAAAAAAGTGCACAGTTCACACTGTAGCTATATCACAAC
AAGTGATTAAATACTGGCCAATTTTTTACGTTAGCTGATG
TCAGCCAAACAAGAGAGTTAAATATTATGAACCATGTATA
TTGCAAGATACACTTTTTGTTTTGGATCTACAATTTCTTT
TAAAAACTCAGATTCAGGGCTTGAATTGTAAGTTTGGATG
GTGGAGATGTACAAAAAAAAAAAAATAATAAAGTTTCCAA
ATAAATGTTCTTTCTGCTTGCTTTATAAACTTTTAGTTTT
GTTTGTTGCACTCTTTGGTGGTGGATTTACTTTTTGATTT
TTTTTAAAGAGTCTTTTAATTTGAGCCCTGAATATCTGCA
GGCTGATGTTTTTTATTTGCATATTTTTCCTGTCAGAAAT
CAGGGCCAAATGTTGAGTGTTTTTAAAGCTGAATAATAAA
AGGAAATAATATTTGAATTGAAGAGGACAGAATCTCGCCG
GATGAGATTTATTTTTATTTTTTTCTCCCTCTAGCATGTT
CACATACATTTGCAGTATTTGCCACAATGTGAGCACTATG
AATCTCTTTACATAAATAAAAGCTACTGAAATGTCCAAAC
CCAA

sparc TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA sparc-201 1724
sparc-202 (1)    Ensembl 865
sparc-203 (1)    Ensembl 544
sparc-206 (1)    Ensembl 520
ncRNA sparc-005 (1)    Ensembl 836
sparc-006 (1)    Ensembl 726
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
sparc-201 Contained in:
[BAC] DKEY-97O1 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000026460 (1),  Ensembl_Trans:ENSDART00000039660 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC071436 (1) 1688 bp
GenBank:AY575072 (1) 1327 bp
GenBank:EB864294 (1) 332 bp
CITATIONS (2)