ZFIN ID: ZDB-TSCRIPT-090929-9136
Transcript Name: sparc-206
Previous Name: sparc-003

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000026462 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000026462|OTTDARG00000020966|ZDB-GENE-030131-9 sparc|OTTDARP00000021705 sparc-003 LG_ BX640507.8 Danio rerio protein_coding KNOWN, 520 bp
TCAGAAAGTTTCACCAGCTGACTTCTCCTCTGGCTTCTCT
GTAAGACGGACAGAAGACGGTTGCTCGGGATGAAGCAGTA
GTAATAACAACAGAACGGTTTAACTTACACACAGCGCTGG
GGGAAGGGCTGACCACTTAGAAAGGTCAGGTACTGCCACT
GTGTAACATTATTGCGCCTGCTGCAGCCATTATGTACCAA
GTTCCTTGTTCCTTGCTGAAACTCAAGATGAGGGTTTGGA
TCTTCTTCCTGTTCTGCCTCGCTGGCAAGACTCTGGCAGC
TCCAACTGAAGAGGAGCCAGCTGTTGAAGAGGAGCTGGAA
GTGGGAATAAACCCAGTCCAGGTGGAGACCGGAGAGTTTG
ATGAAGCCATTGAGGTCGTGGAGGATGTTATTGCTGAGAA
CCCCTGCCTAAACCATCACTGCAAGAAGGGCAAAGTGTGT
GAGGTAGATGACAGCAACCAGCCCATGTGTGTGTGCCAGG
ACCCTTTGACCTGCCCCGCTCCAATCGGAGACTTCGAGCA

sparc TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA sparc-201 (1)    Ensembl 1724
sparc-202 (1)    Ensembl 865
sparc-203 (1)    Ensembl 544
sparc-206 520
ncRNA sparc-005 (1)    Ensembl 836
sparc-006 (1)    Ensembl 726
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
sparc-206 Contained in:
[BAC] DKEY-97O1 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000026462 (1),  Ensembl_Trans:ENSDART00000146022 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:EB863139 (1) 428 bp
CITATIONS (2)