Transcript

sparc-202

ID
ZDB-TSCRIPT-090929-9135
Name
sparc-202
Previous Names
  • sparc-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000026461 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000026461|OTTDARG00000020966|ZDB-GENE-030131-9 sparc|OTTDARP00000021704 sparc-002 LG_ BX640507.8 Danio rerio protein_coding KNOWN, 865 bp
TTTCACCAGCTGACTTCTCCTCTGGCTTCTCTGTAAGACG
GACAGAAGACGGTTGCTCGGGATGAAGCAGTAGTAATAAC
AACAGAACGGTTTAACTTACACACAGCGCTGGGGGAAGGG
CTGACCACTTAGAAAGGTCAGGCTGAAACTCAAGATGAGG
GTTTGGATCTTCTTCCTGTTCTGCCTCGCTGGCAAGACTC
TGGCAGCTCCAACTGAAGAGGAGCCAGCTGTTGAAGAGGA
GCTGGAAGTGGGAATAAACCCAGTCCAGGTGGAGACCGGA
GAGTTTGATGAAGCCATTGAGGTCGTGGAGGATGTTATTG
CTGAGAACCCCTGCCTAAACCATCACTGCAAGAAGGGCAA
AGTGTGTGAGGTAGATGACAGCAACCAGCCCATGTGTGTG
TGCCAGGACCCTTTGACCTGCCCCGCTCCAATCGGAGACT
TCGAGCATGTCTGCGGCACTAACAACAAGACCTACGAGTC
CTCCTGCCACTTCTTTGCCACCAAATGCTCTCTGGAGGGC
ACCAAGAAGGGCCACAAGCTGCACATGGATTACATCGGAC
CCTGCAAATACATCGCTCCCTGCTTGGAGAATGAGCTGAA
TGAGTTCCCCCTGCGCATGAGAGACTGGCTGAAGAACGTG
CTGGTGACTTTGTATGAGCGTGATGAGGACAACAACCTGC
TCACCGAGAAGCAGAAACTCAGGGTGAAGAAGATTTACGA
GAATGAGAAGAGGCTTCAGGCTGGTGATCACTCTCTGGAC
CTTTTGGCCCTGGACTTTGAAAAGAACTACAACATGTACA
TCTTCCCCGTTCACTGGCAGTTTGGCCAGCTTGACCAGCA
CCCTATTGATGGGTATGCTGTCTCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations