header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-23229
Transcript Name: ottdart00000001972
Previous Names: busm1-223c6.1-001, cacna1d-001, dZ223C6.1-001, si:busm1-223c6.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status: fragmented
Strain: AB
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000001972 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000001972|OTTDARG00000001845|ZDB-GENE-030616-135 cacna1da|OTTDARP00000001746 BUSM1-223C6.1-001 LG_ AL714030.6 Danio rerio protein_coding NOVEL, 4125 bp
AGAGTTCTCTAAAGAGCGAGAGAAGGCGAAGGCTCGTGGA
GATTTCCAGAAGCTTCGAGAGAAACAGCAGCTGGAGGAAG
ATCTGAAAGGTTATCTGGACTGGATCACGCAGGCTGAGGA
CATCGACCCTGAGAACGAGGAGGAAGAGGAGGAGAGCAAA
CGCAACCGGGTTACACTGGCCAGCCTCATGGAGAAGAAGA
AGAAGGGGTTTGGCTGGTTCAGCCAGTCCTCTGACACTCA
TGCGAGTATGCCGGCAAGTGAGACTGAATCCATGAATACA
GAGAACGAGAAAGGAGAAGATGAGAAGGCGACATGTTGCG
GCCCGACATGTCGGCGCTGGCGTCGCTGGAACCGGTTGTG
TCGGAGGAATTGTCGCTTGGCTGTAAAATCTGTGCCATTC
TATTGGCTGGTAATCATCCTGGTGTTCCTGAACACTTTGA
CCATCTCTTCAGAACATTACAACCAGCCCATGTGGCTCAC
ACAAGTACAGGATGTGGCTAATAAAGTGCTGCTGGCCATG
TTCACGTGTGAGATGTTGGTAAAGATGTACAGTCTGGGCC
TGCAGGCCTATTTTGTGTCTCTTTTTAATCGCTTTGACTG
CTTTGTGGTGTGTGGAGGCATCACTGAAACCATCCTTGTG
GAGTTTGAGATTATGTCACCCCTCGGCATCTCAGTGTTTC
GATGTGTTCGACTTCTCAGGATCTTTAAAGTTACACGCCA
CTGGGCGTCTCTCAGTAACCTGGTGGCATCTCTGCTGAAC
TCCATGAAGTCCATTGCTTCTCTACTGCTGCTGCTCTTCC
TCTTCATCATCATCTTTAGCCTCCTCGGTATGCAGGTGTT
CGGCGGCAAGTTTAACTTTGACGAGACACAAACCAAGAGG
AGCACCTTTGACAACTTCCCTCAGGCCTTGCTCACTGTGT
TTCAGATTCTAACTGGTGAAGACTGGAATGCCGTCATGTA
TGACGGAATTATGGCGTACGGCGGCCCTTCGTCATCAGGA
ATGATTGTGTGCATCTACTTCATCATCCTTTTCATCTGTG
GAAACTACATTCTCCTGAATGTGTTCTTGGCTATCGCTGT
GGACAATCTTGCTGATGCAGAGTCTCTGAACACGGACGAT
ACGAAGAAACCATCTCAGAGCTTGTTAAGAAGGAGAAGAT
CACTCCAATCCCAGAGGGCAGTGCGTTCTTCATCTTCAGC
AACACAAACCCTTCGAGTCGCCTGCCACAAGCTGATAAAC
CACCACATCTTCACCAACCTCATCCTTGTGTTCATTATGC
TAAGCTCAGCGTCATTGGCTGCTGAGGATCCAATCAGAAA
CTTCTCTGCTAGGAATATTATACTTGGTTACTTTGACTAT
GCTTTCACGGCTATCTTTACTGTAGAGATCGTGTTAAAGG
TCCTAGGCTATGCAGATTATGTCTTCACTAGTATGTTTAC
ATTTGAGATCGTGTTAAAGATGACCACGTATGGCGCTTTT
CTCCATAAGGGTGCTTTCTGCAGGAACTACTTTAATCTTC
TAGATCTGCTGGTGGTCGGAGTTTCGCTCGTGTCCTTCGG
GATTCAATCATCGGCCATTTCAGTGGTGAAGATTCTGAGG
GTTCTGAGAGTTTTGCGTCCACTCAGAGCCATAAACAGAG
CTAAAGGACTAAAGCATGTGGTCCAGTGTGTGTTTGTGGC
CATCAGGACTATAGGAAACATCATGATCGTCACCACTCTG
CTGCAGTTTATGTTCGCCTGCATTGGTGTCCAGCTCTTCA
AGGGAAAGTTTTACCGTTGTAACGATGAGGCCAAGTCCAG
CCCAGAGGAGTGCAAGGGAACGTACATCATGTATAAGGAA
GGAGACGTGAACCAGCCAATCATTCAGAAGCGCCACTGGC
ACAACAGTGATTTCAACTTTGACAATGTGCTCATGGCCAT
GATGGCTCTGTTCACCGTGTCCACGTTTGAAGGCTGGCCA
GCGTTGCTGTACAAGGCCATCGACTCCAACCGGGAGAACA
TGGGTCCCATCTACAACTACCGGGTGGAGATTTCCATCTT
CTTCATCATCTACATCATCATCATCGCTTTCTTTATGATG
AACATCTTTGTGGGTTTCGTCATCGTGACCTTTCAGGAAC
AGGGAGAGAAGGAGTACAAGAACTGTGAGCTGGACAAGAA
CCAGCGTCAGTGTGTGGAGTATGCATTGAAAGCACGTCCT
CTCAGGAGGTACATCCCAAAGAACCCGTATCAGTATAAGT
TCTGGTATGTGGTGAACTCCACCGGCTTCGAGTACATCAT
GTTTGTCCTGATTTTACTCAACACCATCTGTCTCGCCGTG
CAGCACTATGGTCAGTCTGAGCTCTTCAATTATGTTATGG
ACATTCTGAATATGGTCTTCACTGCCGTCTTCACTGTGGA
GATGGTGCTCAAGCTGATCGCCTTCAAGCCTCGGGGATAT
TTTGGGGATGCCTGGAACGTCTTTGACGCTTTGGTTGTGA
TCGGCAGCATTGTAGACATAGTGCTCAGTGAGATTGATCA
TTATTTCACTGACGCATGGAACACATTTGACGCCTTAATT
GTTGTCGGTAGCGTCGTAGATATTGCTATCACGGAAGTCA
ACAACACTGAGGACAGCGCTCGCATTTCCATCACTTTCTT
CCGTCTTTTTCGAGTGATGCGATTGGTCAAGCTGCTGAGC
AGAGGGGAGGGAATTCGAACCCTACTCTGGACCTTTATCA
AATCCTTCCAGGCACTGCCTTATGTTGCTTTGCTGATAGC
CATGCTCTTCTTCATCTACGCTGTCATTGGCATGCAGGTG
TTTGGGAAAATTGCCATGGTGGATCACACTCAAATCAACA
GGAACAACAACTTTCAGACGTTCCCTCAGGCTGTGCTTCT
GCTCTTCAGGTGTGCTACGGGTGAAGCCTGGCAGGAGATC
ATGTTAGCATGTATGCCAGGCAAGCTGTGTGACCCGGAGT
CAGACTATAATCCTGGGGAAGAAATGACCTGCGGGAGCAG
TTTCGCCATCATCTACTTCATCACCTTCTACATGCTCTGC
GCCTTCCTGATCATTAACCTGTTTGTGGCTGTCATCATGG
ACAACTTCGACTATCTGACCCGTGATTGGTCAATTCTGGG
GCCACATCACCTTGATGAGTTTAAGAGGATTTGGTCAGAA
TATGACCCAGAGGCCAAGGGCAGAATAAAACATCTTGATG
TAGTGACGTTGTTGCGCCGTATTCAGCCTCCTCTCGGCTT
TGGGAAACTCTGTCCTCATAGAGTCGCCTGCAAGAGGCTG
GTGGCTATGAACATGCCCCTGAACAGTGACGGCACGGTCA
TGTTTAACGCGACACTGTTTGCTCTCGTGAGAACCGCATT
GAAAATCAAAACAGAAGGTAACCTAGAACAAGCGAATGAA
GAGCTCCGAGCTGTGATTAAGAAGATCTGGAAGAGAACAA
GCATGAAGCTTCTGGATCAAGTGGTTCCCCCTGCTGGTGA
TGATGAGGTAACGGTGGGGAAGTTCTATGCCACTTTCCTG
ATACAGGACTACTTTAGGAAATTCAAGAAACGCAAAGAGG
AAGGCCTGGTGGGAGTTCATCCGGCACAGAACAACACGGC
CATCGCACTGCAGGCTGGCCTTCGTACGCTGCATGACATT
GGGCCAGAAATCCGCCGCGCGATATCATGTGACCTGCAGG
ATGATGAGCTAGTAGACTTTATACCAGAGGAGGACGAAGA
AATTTATAGGCGAAACGGAGGACTCTTTGGCAACCACATC
AACCACATAAACGGAGACCCCCGGAGGAGCTCTGGCCACC
AAACAAACGCCACACAGCGCCCCCTGCAGGTGCAGCCGCC
CCCACATTACGTCCACATGGAGCAGCCCGTGGGGCGTCTG
GGTCGCGCCAATGCCATGGCACAGCAAAACCATCATCGTC
ACCACCACCACCATCACCATCATCATCATCACAACAACTC
CTACAACAAATCGCCCAAGTCCACCAACATCAACCTCAAC
AACGCCAACGTGTCCAGTTTACCCAATGGTGGACACAATC
GCTACTACGAACACGCTCCCGCTAATGGCTACCCAGGGTC
ATATTACGGAGAATACGACAAGCCCAGGACCCCTCATGGG
CAAAG

cacna1da TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA cacna1da-003 (1) 546
ncRNA cacna1da-004 (1) 840
mRNA cacna1da-202 (1) 5981
cacna1fb-207 (1) 6662
ottdart00000001787 (1) 2432
ottdart00000001972 4125
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ottdart00000001972 Contained in:

OTHER ottdart00000001972 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000001972 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCESNo data available
    CITATIONS (1)