header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-23205
Transcript Name: ottdart00000001787
Previous Names: busm1-136d19.3-001, cacna1d-001, dZ136D19.3-001, si:busm1-136d19.3-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status: fragmented
Strain: AB
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000001787 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000001787|OTTDARG00000001673|ZDB-GENE-030616-135 cacna1da|OTTDARP00000001576 BUSM1-136D19.3-001 LG_none AL714030.6,AL713850.6 Danio rerio protein_coding NOVEL, 2432 bp
GGTTGCTGTACAAGGCCATCGACTCCAACCGGGAGAACAT
GGGTCCCATCTACAACTACCGGGTGGAGATTTCCATCTTC
TTCATCATCTACATCATCATCATCGCTTTCTTTATGATGA
ACATCTTTGTGGGTTTCGTCATCGTGACCTTTCAGGAACA
GGGAGAGAAGGAGTACAAGAACTGTGAGCTGGACAAGAAC
CAGCGTCAGTGTGTGGAGTATGCATTGAAAGCACGTCCTC
TCAGGAGGTACATCCCAAAGAACCCGTATCAGTATAAGTT
CTGGTATGTGGTGAACTCCACCGGCTTCGAGTACATCATG
TTTGTCCTGATTTTACTCAACACCATCTGTCTCGCCGTGC
AGCACTATGGTCAGTCTGAGCTCTTCAATTATGTTATGGA
CATTCTGAATATGGTCTTCACTGCCGTCTTCACTGTGGAG
ATGGTGCTCAAGCTGATCGCCTTCAAGCCTCGGTATTTTG
GGGATGCCTGGAACGTCTTTGACGCTTTGGTTGTGATCGG
CAGCATTGTAGACATAGTGCTCAGTGAGATTGATCATTAT
TTCACTGACGCATGGAACACATTTGACGCCTTAATTGTTG
TCGGTAGCGTCGTAGATATTGCTATCACGGAAGTCAACAA
CACTGAGGACAGCGCTCGCATTTCCATCACTTTCTTCCGT
CTTTTTCGAGTGATGCGATTGGTCAAGCTGCTGAGCAGAG
GGGAGGGAATTCGAACCCTACTCTGGACCTTTATCAAATC
CTTCCAGGCACTGCCTTATGTTGCTTTGCTGATAGCCATG
CTCTTCTTCATCTACGCTGTCATTGGCATGCAGGTGTTTG
GGAAAATTGCCATGGTGGATCACACTCAAATCAACAGGAA
CAACAACTTTCAGACGTTCCCTCAGGCTGTGCTTCTGCTC
TTCAGGTGTGCTACGGGTGAAGCCTGGCAGGAGATCATGT
TAGCATGTATGCCAGGCAAGCTGTGTGACCCGGAGTCAGA
CTATAATCCTGGGGAAGAAATGACCTGCGGGAGCAGTTTC
GCCATCATCTACTTCATCACCTTCTACATGCTCTGCGCCT
TCCTGATCATTAACCTGTTTGTGGCTGTCATCATGGACAA
CTTCGACTATCTGACCCGTGATTGGTCAATTCTGGGGCCA
CATCACCTTGATGAGTTTAAGAGGATTTGGTCAGAATATG
ACCCAGAGGCCAAGGGCAGAATAAAACATCTTGATGTAGT
GACGTTGTTGCGCCGTATTCAGCCTCCTCTCGGCTTTGGG
AAACTCTGTCCTCATAGAGTCGCCTGCAAGAGGCTGGTGG
CTATGAACATGCCCCTGAACAGTGACGGCACGGTCATGTT
TAACGCGACACTGTTTGCTCTCGTGAGAACCGCATTGAAA
ATCAAAACAGAAGGTAACCTAGAACAAGCGAATGAAGAGC
TCCGAGCTGTGATTAAGAAGATCTGGAAGAGAACAAGCAT
GAAGCTTCTGGATCAAGTGGTTCCCCCTGCTGGTGATGAT
GAGGTAACGGTGGGGAAGTTCTATGCCACTTTCCTGATAC
AGGACTACTTTAGGAAATTCAAGAAACGCAAAGAGGAAGG
CCTGGTGGGAGTTCATCCGGCACAGAACAACACGGCCATC
GCACTGCAGGCTGGCCTTCGTACGCTGCATGACATTGGGC
CAGAAATCCGCCGCGCGATATCATGTGACCTGCAGGATGA
TGAGCTAGTAGACTTTATACCAGAGGAGGACGAAGAAATT
TATAGGGTAATCGGAGACCGTCGTTCAATTTTGAGTGTCT
GCGCAGACAGAGCAGTCAAGACGATCTTCCTCACCAGCGA
ACTGCTCTTCCGTTACATCTCATGCAACACCAGATCATGG
GCTTCACCTCCTCCAACTCCTGCAAGTAAAGACCGGACGC
CGTACTACACACCGCTCATCCGCGTGGACCGTCCTCTAAG
AGACAGCGCCAGCAGCAGCCATTCATCCATCAGGAAGAGC
TCGTGGTACACAGACGACCCTGAGTACCAGCAGAGGAACT
TCTCACCTGTTCACCTGCAGGTCCCACCCGAGTACAGGAA
CCAGTACCTGCAGAAGAGAGGCAGCGCTACCAGCCTGGTG
GAGGCGGTCTTGATATCAGAAGGACTGGGTCGATACGCCA
AGGATCCCAAATTTGTGGCCGCCACAAAGCATGAGATTGC
GGACGCGTGCGAGATGACCATTGACGAAATGGAAAGCGCC
GCCAGCCATCTTCTTAACGGTGGCATTACACCAGTAGTCA
ACGGAGTCAATGTGTTTCCCATACTGGGCCACAGAGACTA
CGAGCTGCAGGACGTCTCGGCGAGCTACAGCGACGAGGAG
CCCGAACCCGAGCCCAGACCTCGTTACGAGGAGGACCTTG
CAGATGAAATGATATGCATTACCACTTTATAG

cacna1da TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA cacna1da-003 (1) 546
ncRNA cacna1da-004 (1) 840
mRNA cacna1da-202 (1) 5981
cacna1fb-207 (1) 6662
ottdart00000001787 2432
ottdart00000001972 (1) 4125
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ottdart00000001787 Contained in:

OTHER ottdart00000001787 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000001787 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AF305689 (1) 6776 bp
    CITATIONS (1)