ZFIN ID: ZDB-MRPHLNO-170208-2
Morpholino Name: MO8-chd7
Target: chd7 (1)
Sequence:
5' - ATGGAGGGTCAATTCTAACCTCAGT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO8-chd7 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO8-chd7
Expressed Gene Anatomy Figures
crestin Fig. 5Fig. S5 from Asad et al., 2016
dct Fig. 4 from Asad et al., 2016
dlx2a Fig. 7 from Asad et al., 2016
egr2b Fig. S6 from Asad et al., 2016
foxd3 Fig. 2Fig. 6 from Asad et al., 2016
isl2a Fig. 5Fig. S5 from Asad et al., 2016
mbpa Fig. 6 from Asad et al., 2016
mitfa Fig. 4 from Asad et al., 2016
neurod1 Fig. 5Fig. S5 from Asad et al., 2016
snai2 Fig. 2 from Asad et al., 2016
sox2 Fig. 2 from Asad et al., 2016
sox9a Fig. 2Fig. 7 from Asad et al., 2016
sox9b Fig. 7 from Asad et al., 2016
sox10 Fig. 3 from Asad et al., 2016
tfap2a Fig. 2 from Asad et al., 2016
tyr Fig. 4 from Asad et al., 2016
PHENOTYPE
Phenotype resulting from MO8-chd7
Phenotype Figures
brain glial cell (sensu Vertebrata) egr2b expression decreased amount, abnormal Fig. S6 from Asad et al., 2016
ceratobranchial cartilage absent, abnormal Fig. 7 from Asad et al., 2016
ceratohyal cartilage absent, abnormal Fig. 7 from Asad et al., 2016
cranial motor neuron isl2a expression decreased amount, abnormal Fig. S5 from Asad et al., 2016
cranium glial cell foxd3 expression absent, abnormal Fig. 6 from Asad et al., 2016
cranium glial cell (sensu Vertebrata) absent, abnormal Fig. 6 from Asad et al., 2016
enteric neuron decreased amount, abnormal Fig. S5 from Asad et al., 2016
enteric neuron crestin expression decreased amount, abnormal Fig. 5 from Asad et al., 2016
epibranchial cartilage neuroblast neurod1 expression decreased amount, abnormal Fig. 5 from Asad et al., 2016
eye iridophore absent, abnormal Fig. 4 from Asad et al., 2016
head decreased size, abnormal Fig. 7 from Asad et al., 2016
head melanoblast GFP expression increased amount, abnormal Fig. 4 from Asad et al., 2016
head neuroblast neurod1 expression decreased amount, abnormal Fig. S5 from Asad et al., 2016
lateral line glial cell egr2b expression decreased amount, abnormal Fig. S6 from Asad et al., 2016
lateral line glial cell (sensu Vertebrata) foxd3 expression increased amount, abnormal Fig. 6 from Asad et al., 2016
lateral line glial cell (sensu Vertebrata) GFP expression increased amount, abnormal Fig. 6 from Asad et al., 2016
lateral line glial cell (sensu Vertebrata) morphology, abnormal Fig. 6 from Asad et al., 2016
Meckel's cartilage absent, abnormal Fig. 7 from Asad et al., 2016
melanocyte tyr expression decreased amount, abnormal Fig. 4 from Asad et al., 2016
melanocyte dct expression decreased amount, abnormal Fig. 4 from Asad et al., 2016
microvillous olfactory receptor neuron decreased amount, abnormal Fig. 5 from Asad et al., 2016
microvillous olfactory receptor neuron disorganized, abnormal Fig. 5 from Asad et al., 2016
migratory neural crest mislocalised, abnormal Fig. 3 from Asad et al., 2016
motor neuron isl2a expression decreased amount, abnormal Fig. 5 from Asad et al., 2016
myelinating Schwann cell mbpa expression decreased amount, abnormal Fig. 6 from Asad et al., 2016
myelinating Schwann cell mbpa expression decreased distribution, abnormal Fig. 6 from Asad et al., 2016
myelinating Schwann cell foxd3 expression increased amount, abnormal Fig. 6 from Asad et al., 2016
myelinating Schwann cell myelination disrupted, abnormal Fig. 6 from Asad et al., 2016
neural crest foxd3 expression increased amount, abnormal Fig. 2 from Asad et al., 2016
neural crest sox10 expression spatial pattern, abnormal Fig. 3 from Asad et al., 2016
neural crest melanoblast mitfa expression increased amount, abnormal Fig. 4 from Asad et al., 2016
neural crest melanoblast GFP expression increased amount, abnormal Fig. 4 from Asad et al., 2016
neural crest cell sox10 expression decreased amount, abnormal Fig. 3 from Asad et al., 2016
neural crest cell sox9a expression decreased amount, abnormal Fig. 2 from Asad et al., 2016
neural crest cell snai2 expression decreased amount, abnormal Fig. 2 from Asad et al., 2016
neural crest cell migration delayed, abnormal Fig. 3 from Asad et al., 2016
neural crest cell migration disrupted, abnormal Fig. 2Fig. 3 from Asad et al., 2016
neural keel sox2 expression decreased amount, abnormal Fig. 2 from Asad et al., 2016
neural plate border sox10 expression decreased amount, abnormal Fig. 3 from Asad et al., 2016
neuromast absent, abnormal Fig. 5 from Asad et al., 2016
neuromast decreased amount, abnormal Fig. 5 from Asad et al., 2016
olfactory receptor cell decreased amount, abnormal Fig. S5 from Asad et al., 2016
pericardium edematous, abnormal Fig. 7 from Asad et al., 2016
perichondrium sox9b expression decreased amount, abnormal Fig. 7 from Asad et al., 2016
perichondrium disorganized, abnormal Fig. 7 from Asad et al., 2016
pharyngeal arch chondrocyte sox9a expression absent, abnormal Fig. 7 from Asad et al., 2016
pharyngeal arch neural crest cell dlx2a expression decreased amount, abnormal Fig. 7 from Asad et al., 2016
sensory neuron isl2a expression decreased amount, abnormal Fig. 5 from Asad et al., 2016
somite foxd3 expression increased amount, abnormal Fig. 2 from Asad et al., 2016
trunk sox10 expression spatial pattern, abnormal Fig. 3 from Asad et al., 2016
trunk iridophore absent, abnormal Fig. 4 from Asad et al., 2016
vagal neural crest crestin expression decreased amount, abnormal Fig. S5 from Asad et al., 2016
ventral mandibular arch absent, abnormal Fig. 7 from Asad et al., 2016
whole organism decreased pigmentation, abnormal Fig. 4Fig. S4 from Asad et al., 2016
whole organism foxd3 expression increased amount, abnormal Fig. 2 from Asad et al., 2016
whole organism sox10 expression increased amount, abnormal Fig. 3 from Asad et al., 2016
whole organism Melanin decreased amount, abnormal Fig. 4 from Asad et al., 2016
whole organism melanocyte shape, abnormal Fig. 4 from Asad et al., 2016

Phenotype of all Fish created by or utilizing MO8-chd7
Phenotype Fish Conditions Figures
neural keel sox2 expression decreased amount, abnormal TU + MO8-chd7 standard conditions Fig. 2 from Asad et al., 2016
vagal neural crest crestin expression decreased amount, abnormal TU + MO8-chd7 standard conditions Fig. S5 from Asad et al., 2016
somite foxd3 expression increased amount, abnormal TU + MO8-chd7 standard conditions Fig. 2 from Asad et al., 2016
eye iridophore absent, abnormal TU + MO8-chd7 standard conditions Fig. 4 from Asad et al., 2016
whole organism decreased pigmentation, abnormal TU + MO8-chd7 standard conditions Fig. 4 from Asad et al., 2016
trunk iridophore absent, abnormal TU + MO8-chd7 standard conditions Fig. 4 from Asad et al., 2016
whole organism sox10 expression increased amount, abnormal TU + MO8-chd7 standard conditions Fig. 3 from Asad et al., 2016
neural crest sox10 expression spatial pattern, abnormal TU + MO8-chd7 standard conditions Fig. 3 from Asad et al., 2016
whole organism melanocyte shape, abnormal TU + MO8-chd7 standard conditions Fig. 4 from Asad et al., 2016
neural crest cell migration delayed, abnormal TU + MO8-chd7 standard conditions Fig. 3 from Asad et al., 2016
pericardium edematous, abnormal TU + MO8-chd7 standard conditions Fig. 7 from Asad et al., 2016
whole organism foxd3 expression increased amount, abnormal TU + MO8-chd7 standard conditions Fig. 2 from Asad et al., 2016
neuromast absent, abnormal TU + MO8-chd7 standard conditions Fig. 5 from Asad et al., 2016
cranium glial cell (sensu Vertebrata) absent, abnormal TU + MO8-chd7 standard conditions Fig. 6 from Asad et al., 2016
myelinating Schwann cell myelination disrupted, abnormal TU + MO8-chd7 standard conditions Fig. 6 from Asad et al., 2016
pharyngeal arch neural crest cell dlx2a expression decreased amount, abnormal TU + MO8-chd7 standard conditions Fig. 7 from Asad et al., 2016
myelinating Schwann cell mbpa expression decreased distribution, abnormal TU + MO8-chd7 standard conditions Fig. 6 from Asad et al., 2016
neural crest cell snai2 expression decreased amount, abnormal TU + MO8-chd7 standard conditions Fig. 2 from Asad et al., 2016
cranial motor neuron isl2a expression decreased amount, abnormal TU + MO8-chd7 standard conditions Fig. S5 from Asad et al., 2016
perichondrium disorganized, abnormal TU + MO8-chd7 standard conditions Fig. 7 from Asad et al., 2016
myelinating Schwann cell mbpa expression decreased amount, abnormal TU + MO8-chd7 standard conditions Fig. 6 from Asad et al., 2016
perichondrium sox9b expression decreased amount, abnormal TU + MO8-chd7 standard conditions Fig. 7 from Asad et al., 2016
epibranchial cartilage neuroblast neurod1 expression decreased amount, abnormal TU + MO8-chd7 standard conditions Fig. 5 from Asad et al., 2016
neural plate border sox10 expression decreased amount, abnormal TU + MO8-chd7 standard conditions Fig. 3 from Asad et al., 2016
neural crest cell migration disrupted, abnormal TU + MO8-chd7 standard conditions Fig. 2Fig. 3 from Asad et al., 2016
melanocyte tyr expression decreased amount, abnormal TU + MO8-chd7 standard conditions Fig. 4 from Asad et al., 2016
neural crest foxd3 expression increased amount, abnormal TU + MO8-chd7 standard conditions Fig. 2 from Asad et al., 2016
brain glial cell (sensu Vertebrata) egr2b expression decreased amount, abnormal TU + MO8-chd7 standard conditions Fig. S6 from Asad et al., 2016
neural crest melanoblast mitfa expression increased amount, abnormal TU + MO8-chd7 standard conditions Fig. 4 from Asad et al., 2016
neural crest cell sox10 expression decreased amount, abnormal TU + MO8-chd7 standard conditions Fig. 3 from Asad et al., 2016
motor neuron isl2a expression decreased amount, abnormal TU + MO8-chd7 standard conditions Fig. 5 from Asad et al., 2016
pharyngeal arch chondrocyte sox9a expression absent, abnormal TU + MO8-chd7 standard conditions Fig. 7 from Asad et al., 2016
neural crest cell sox9a expression decreased amount, abnormal TU + MO8-chd7 standard conditions Fig. 2 from Asad et al., 2016
cranium glial cell foxd3 expression absent, abnormal TU + MO8-chd7 standard conditions Fig. 6 from Asad et al., 2016
lateral line glial cell (sensu Vertebrata) foxd3 expression increased amount, abnormal TU + MO8-chd7 standard conditions Fig. 6 from Asad et al., 2016
sensory neuron isl2a expression decreased amount, abnormal TU + MO8-chd7 standard conditions Fig. 5 from Asad et al., 2016
myelinating Schwann cell foxd3 expression increased amount, abnormal TU + MO8-chd7 standard conditions Fig. 6 from Asad et al., 2016
head neuroblast neurod1 expression decreased amount, abnormal TU + MO8-chd7 standard conditions Fig. S5 from Asad et al., 2016
neuromast decreased amount, abnormal TU + MO8-chd7 standard conditions Fig. 5 from Asad et al., 2016
migratory neural crest mislocalised, abnormal TU + MO8-chd7 standard conditions Fig. 3 from Asad et al., 2016
lateral line glial cell egr2b expression decreased amount, abnormal TU + MO8-chd7 standard conditions Fig. S6 from Asad et al., 2016
melanocyte dct expression decreased amount, abnormal TU + MO8-chd7 standard conditions Fig. 4 from Asad et al., 2016
head decreased size, abnormal TU + MO8-chd7 standard conditions Fig. 7 from Asad et al., 2016
whole organism Melanin decreased amount, abnormal TU + MO8-chd7 standard conditions Fig. 4 from Asad et al., 2016
enteric neuron crestin expression decreased amount, abnormal TU + MO8-chd7 standard conditions Fig. 5 from Asad et al., 2016
ventral mandibular arch absent, abnormal TU + MO8-chd7 standard conditions Fig. 7 from Asad et al., 2016
ceratohyal cartilage absent, abnormal ba2Tg + MO8-chd7 standard conditions Fig. 7 from Asad et al., 2016
ceratobranchial cartilage absent, abnormal ba2Tg + MO8-chd7 standard conditions Fig. 7 from Asad et al., 2016
neural crest cell migration disrupted, abnormal ba2Tg + MO8-chd7 standard conditions Fig. 3 from Asad et al., 2016
Meckel's cartilage absent, abnormal ba2Tg + MO8-chd7 standard conditions Fig. 7 from Asad et al., 2016
olfactory receptor cell decreased amount, abnormal ba2Tg + MO8-chd7 standard conditions Fig. S5 from Asad et al., 2016
trunk sox10 expression spatial pattern, abnormal ba2Tg + MO8-chd7 standard conditions Fig. 3 from Asad et al., 2016
whole organism decreased pigmentation, abnormal w47Tg + MO8-chd7 standard conditions Fig. S4 from Asad et al., 2016
neural crest melanoblast GFP expression increased amount, abnormal w47Tg + MO8-chd7 control Fig. 4 from Asad et al., 2016
head melanoblast GFP expression increased amount, abnormal w47Tg + MO8-chd7 control Fig. 4 from Asad et al., 2016
lateral line glial cell (sensu Vertebrata) GFP expression increased amount, abnormal zf15Tg + MO8-chd7 standard conditions Fig. 6 from Asad et al., 2016
lateral line glial cell (sensu Vertebrata) morphology, abnormal zf15Tg + MO8-chd7 standard conditions Fig. 6 from Asad et al., 2016
enteric neuron decreased amount, abnormal zf148Tg + MO8-chd7 standard conditions Fig. S5 from Asad et al., 2016
microvillous olfactory receptor neuron decreased amount, abnormal zf148Tg + MO8-chd7 standard conditions Fig. 5 from Asad et al., 2016
microvillous olfactory receptor neuron disorganized, abnormal zf148Tg + MO8-chd7 standard conditions Fig. 5 from Asad et al., 2016
cranial motor neuron isl2a expression decreased amount, abnormal TU + MO1-sox10 + MO8-chd7 standard conditions Fig. S5 from Asad et al., 2016
myelinating Schwann cell myelination process quality, ameliorated TU + MO1-sox10 + MO8-chd7 standard conditions Fig. 6 from Asad et al., 2016
head neuroblast neurod1 expression decreased amount, abnormal TU + MO1-sox10 + MO8-chd7 standard conditions Fig. S5 from Asad et al., 2016
pharyngeal arch chondrocyte sox9a expression absent, abnormal TU + MO1-sox10 + MO8-chd7 standard conditions Fig. 7 from Asad et al., 2016
perichondrium sox9b expression decreased amount, abnormal TU + MO1-sox10 + MO8-chd7 standard conditions Fig. 7 from Asad et al., 2016
melanocyte dct expression decreased amount, abnormal TU + MO1-sox10 + MO8-chd7 standard conditions Fig. 4 from Asad et al., 2016
perichondrium disorganized, abnormal TU + MO1-sox10 + MO8-chd7 standard conditions Fig. 7 from Asad et al., 2016
head melanoblast mitfa expression decreased amount, abnormal TU + MO1-sox10 + MO8-chd7 standard conditions Fig. 4 from Asad et al., 2016
melanocyte tyr expression decreased amount, abnormal TU + MO1-sox10 + MO8-chd7 standard conditions Fig. 4 from Asad et al., 2016
pharyngeal arch neural crest cell dlx2a expression decreased amount, abnormal TU + MO1-sox10 + MO8-chd7 standard conditions Fig. 7 from Asad et al., 2016
vagal neural crest crestin expression decreased amount, abnormal TU + MO1-sox10 + MO8-chd7 standard conditions Fig. S5 from Asad et al., 2016
myelinating Schwann cell mbpa expression position, ameliorated TU + MO1-sox10 + MO8-chd7 standard conditions Fig. 6 from Asad et al., 2016
neural crest melanoblast mitfa expression decreased amount, abnormal TU + MO1-sox10 + MO8-chd7 standard conditions Fig. 4 from Asad et al., 2016
ventral mandibular arch morphology, ameliorated TU + MO1-sox10 + MO8-chd7 standard conditions Fig. 7 from Asad et al., 2016
ventral mandibular arch morphology, ameliorated TU + MO4-sox10 + MO8-chd7 standard conditions Fig. S7 from Asad et al., 2016
myelinating Schwann cell mbpa expression position, ameliorated TU + MO4-sox10 + MO8-chd7 standard conditions Fig. S6 from Asad et al., 2016
pharyngeal arch cartilage morphology, ameliorated TU + MO4-sox10 + MO8-chd7 standard conditions Fig. S7 from Asad et al., 2016
Meckel's cartilage morphology, ameliorated ba2Tg + MO1-sox10 + MO8-chd7 standard conditions Fig. 7 from Asad et al., 2016
ceratobranchial cartilage morphology, ameliorated ba2Tg + MO1-sox10 + MO8-chd7 standard conditions Fig. 7 from Asad et al., 2016
olfactory receptor cell decreased amount, abnormal ba2Tg + MO1-sox10 + MO8-chd7 standard conditions Fig. S5 from Asad et al., 2016
ceratohyal cartilage morphology, ameliorated ba2Tg + MO1-sox10 + MO8-chd7 standard conditions Fig. 7 from Asad et al., 2016
whole organism decreased pigmentation, abnormal w47Tg + MO1-sox10 + MO8-chd7 standard conditions Fig. S4 from Asad et al., 2016
enteric neuron decreased amount, abnormal zf148Tg + MO1-sox10 + MO8-chd7 standard conditions Fig. S5 from Asad et al., 2016
Genome Resources:
CITATIONS (1)