header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-151116-4
Morpholino Name: MO1-egfl6
Target: egfl6 (1)
Sequence:
5' - TGATCCACGTCAGATGTTTCATGGT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-egfl6 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-egfl6
Expressed Gene Anatomy Figures
notch2 Fig. 3 from Wang et al., 2015
PHENOTYPE
Phenotype resulting from MO1-egfl6
Phenotype of all Fish created by or utilizing MO1-egfl6
Genome Resources:
CITATIONS (2)