header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-150617-3
Morpholino Name: MO1-epas1a
Target: epas1a (1)
Sequence:
5' - ATGATGCTGAAGAACCTTGTCCTGC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-epas1a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-epas1a No data available
PHENOTYPE
Phenotype resulting from MO1-epas1a
No data available

Phenotype of all Fish created by or utilizing MO1-epas1a
Phenotype Fish Conditions Figures
ventral wall of dorsal aorta runx1 expression decreased amount, abnormal WT + MO1-epas1a + MO3-epas1b heat shock Fig. 6 from Gerri et al., 2018
hematopoietic system runx1 expression decreased amount, abnormal WT + MO1-epas1a + MO3-epas1b heat shock Fig. 6 from Gerri et al., 2018
hematopoietic system myb expression decreased amount, abnormal WT + MO1-epas1a + MO3-epas1b standard conditions Fig. 6 from Gerri et al., 2018
ventral wall of dorsal aorta myb expression decreased amount, abnormal WT + MO1-epas1a + MO3-epas1b standard conditions Fig. 6 from Gerri et al., 2018
ventral wall of dorsal aorta runx1 expression decreased amount, abnormal WT + MO1-epas1a + MO3-epas1b standard conditions Fig. 6 from Gerri et al., 2018
hematopoietic system runx1 expression decreased amount, abnormal WT + MO1-epas1a + MO3-epas1b standard conditions Fig. 6 from Gerri et al., 2018
hematopoietic system myb expression decreased amount, abnormal WT + MO1-epas1a + MO3-epas1b heat shock Fig. 6 from Gerri et al., 2018
ventral wall of dorsal aorta myb expression decreased amount, abnormal WT + MO1-epas1a + MO3-epas1b heat shock Fig. 6 from Gerri et al., 2018
hematopoietic system myb expression increased amount, abnormal kca3Tg; kca4Tg + MO1-epas1a + MO3-epas1b heat shock Fig. 6 from Gerri et al., 2018
ventral wall of dorsal aorta runx1 expression increased amount, abnormal kca3Tg; kca4Tg + MO1-epas1a + MO3-epas1b heat shock Fig. 6 from Gerri et al., 2018
ventral wall of dorsal aorta myb expression increased amount, abnormal kca3Tg; kca4Tg + MO1-epas1a + MO3-epas1b heat shock Fig. 6 from Gerri et al., 2018
hematopoietic system runx1 expression increased amount, abnormal kca3Tg; kca4Tg + MO1-epas1a + MO3-epas1b heat shock Fig. 6 from Gerri et al., 2018
ventral wall of dorsal aorta myb expression increased amount, abnormal kca3Tg; ubs4Tg + MO1-epas1a + MO3-epas1b standard conditions Fig. 6 from Gerri et al., 2018
ventral wall of dorsal aorta runx1 expression increased amount, abnormal kca3Tg; ubs4Tg + MO1-epas1a + MO3-epas1b standard conditions Fig. 6 from Gerri et al., 2018
hematopoietic system runx1 expression increased amount, abnormal kca3Tg; ubs4Tg + MO1-epas1a + MO3-epas1b standard conditions Fig. 6 from Gerri et al., 2018
hematopoietic system myb expression increased amount, abnormal kca3Tg; ubs4Tg + MO1-epas1a + MO3-epas1b standard conditions Fig. 6 from Gerri et al., 2018
ventral wall of dorsal aorta hematopoietic cell decreased amount, abnormal s896Tg; zf169Tg + MO1-epas1a + MO3-epas1b standard conditions Fig. 2 from Gerri et al., 2018
hematopoietic stem cell decreased amount, abnormal s896Tg; zf169Tg + MO1-epas1a + MO3-epas1b standard conditions Fig. 2 from Gerri et al., 2018
ventral wall of dorsal aorta runx1 expression decreased amount, abnormal hif1aabns89/bns89; hif1abbns90/bns90 + MO1-epas1a + MO3-epas1b hypoxia Fig. 4 from Gerri et al., 2018
whole organism runx1 expression decreased amount, abnormal hif1aabns89/bns89; hif1abbns90/bns90 + MO1-epas1a + MO3-epas1b standard conditions Fig. 4 from Gerri et al., 2018
ventral wall of dorsal aorta myb expression decreased amount, abnormal hif1aabns89/bns89; hif1abbns90/bns90 + MO1-epas1a + MO3-epas1b hypoxia Fig. 4 from Gerri et al., 2018
ventral wall of dorsal aorta myb expression decreased amount, abnormal hif1aabns89/bns89; hif1abbns90/bns90 + MO1-epas1a + MO3-epas1b control Fig. 4 from Gerri et al., 2018
whole organism myb expression decreased amount, abnormal hif1aabns89/bns89; hif1abbns90/bns90 + MO1-epas1a + MO3-epas1b standard conditions Fig. 4 from Gerri et al., 2018
ventral wall of dorsal aorta runx1 expression decreased amount, abnormal hif1aabns89/bns89; hif1abbns90/bns90 + MO1-epas1a + MO3-epas1b control Fig. 4 from Gerri et al., 2018
OTHER MO1-epas1a MORPHOLINO PAGES No links to external sites
CITATIONS (2)