header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-140428-3
Morpholino Name: MO1-mettl3
Target: mettl3 (1)
Previous Name: METTL3MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GGATGTGACTCCATGTGTCCGACAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-mettl3 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-mettl3
Expressed Gene Anatomy Figures
gata1a Fig. 2 from Zhang et al., 2017
gsc Fig. S6 with image from Ping et al., 2014
myb Fig. 2 from Zhang et al., 2017
myod1 Fig. 2 with image from Ping et al., 2014
notch1a Fig. 3 from Zhang et al., 2017
rag1 Fig. 2 from Zhang et al., 2017
runx1 Fig. 3 from Zhang et al., 2017
spi1b Fig. 2 from Zhang et al., 2017
PHENOTYPE
Phenotype resulting from MO1-mettl3
Phenotype Figures
apoptotic process increased process quality, abnormal Fig. 2 with image from Ping et al., 2014
endothelial cell EGFP expression increased amount, abnormal Fig. 3 from Zhang et al., 2017
endothelial cell notch1a expression increased amount, abnormal Fig. 3 from Zhang et al., 2017
eye decreased size, abnormal Fig. 2 with image from Ping et al., 2014
head decreased size, abnormal Fig. 2 with image from Ping et al., 2014
notochord curved ventral, abnormal Fig. 2 with image from Ping et al., 2014
thymus has fewer parts of type T cell, abnormal Fig. 2 from Zhang et al., 2017
thymus lymphocyte EGFP expression decreased amount, abnormal Fig. 2 from Zhang et al., 2017
ventral wall of dorsal aorta lacks parts or has fewer parts of type hematopoietic multipotent progenitor cell, abnormal Fig. 2 from Zhang et al., 2017
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell spi1b expression decreased amount, abnormal Fig. 2 from Zhang et al., 2017
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell rag1 expression decreased amount, abnormal Fig. 2 from Zhang et al., 2017
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell gata1a expression decreased amount, abnormal Fig. 2 from Zhang et al., 2017
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell EGFP expression decreased amount, abnormal Fig. 2 from Zhang et al., 2017
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell myb expression decreased amount, abnormal Fig. 2 from Zhang et al., 2017
ventricular system decreased size, abnormal Fig. 2 with image from Ping et al., 2014
whole organism runx1 expression decreased amount, abnormal Fig. 3 from Zhang et al., 2017
whole organism Ab3-notch1 labeling increased amount, abnormal Fig. 3 from Zhang et al., 2017

Phenotype of all Fish created by or utilizing MO1-mettl3
Phenotype Fish Conditions Figures
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell spi1b expression decreased amount, abnormal TU + MO1-mettl3 standard conditions Fig. 2 from Zhang et al., 2017
whole organism runx1 expression decreased amount, abnormal TU + MO1-mettl3 standard conditions Fig. 3 from Zhang et al., 2017
whole organism runx1 expression amount, ameliorated TU + MO1-mettl3 chemical treatment: LY-411575 Fig. 3 from Zhang et al., 2017
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell myb expression decreased amount, abnormal TU + MO1-mettl3 standard conditions Fig. 2 from Zhang et al., 2017
endothelial cell notch1a expression increased amount, abnormal TU + MO1-mettl3 standard conditions Fig. 3 from Zhang et al., 2017
whole organism notch1a expression increased amount, abnormal TU + MO1-mettl3 chemical treatment: actinomycin D Fig. 4 from Zhang et al., 2017
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell rag1 expression decreased amount, abnormal TU + MO1-mettl3 standard conditions Fig. 2 from Zhang et al., 2017
whole organism Ab3-notch1 labeling increased amount, abnormal TU + MO1-mettl3 standard conditions Fig. 3 from Zhang et al., 2017
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell gata1a expression decreased amount, abnormal TU + MO1-mettl3 standard conditions Fig. 2 from Zhang et al., 2017
notochord curved ventral, abnormal WT + MO1-mettl3 standard conditions Fig. 2 with image from Ping et al., 2014
head decreased size, abnormal WT + MO1-mettl3 standard conditions Fig. 2 with image from Ping et al., 2014
eye decreased size, abnormal WT + MO1-mettl3 standard conditions Fig. 2 with image from Ping et al., 2014
ventricular system decreased size, abnormal WT + MO1-mettl3 standard conditions Fig. 2 with image from Ping et al., 2014
apoptotic process increased process quality, abnormal WT + MO1-mettl3 standard conditions Fig. 2 with image from Ping et al., 2014
ventral wall of dorsal aorta lacks parts or has fewer parts of type hematopoietic multipotent progenitor cell, abnormal ioz1Tg; s896Tg + MO1-mettl3 standard conditions Fig. 2 from Zhang et al., 2017
thymus has fewer parts of type T cell, abnormal ioz1Tg; s896Tg + MO1-mettl3 standard conditions Fig. 2 from Zhang et al., 2017
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell EGFP expression decreased amount, abnormal ioz1Tg; s896Tg + MO1-mettl3 standard conditions Fig. 2 from Zhang et al., 2017
thymus lymphocyte EGFP expression decreased amount, abnormal ioz1Tg; s896Tg + MO1-mettl3 standard conditions Fig. 2 from Zhang et al., 2017
endothelial cell EGFP expression increased amount, abnormal jh11Tg; y1Tg + MO1-mettl3 standard conditions Fig. 3 from Zhang et al., 2017
ventral wall of dorsal aorta lacks parts or has fewer parts of type hematopoietic multipotent progenitor cell, abnormal s896Tg; zf169Tg + MO1-mettl3 standard conditions Fig. 2 from Zhang et al., 2017
whole organism runx1 expression amount, ameliorated TU + MO1-mettl3 + MO1-notch1a standard conditions Fig. 3 from Zhang et al., 2017
eye decreased size, abnormal WT + MO1-mettl3 + MO1-wtap standard conditions Fig. 2 with image from Ping et al., 2014
ventricular system decreased size, abnormal WT + MO1-mettl3 + MO1-wtap standard conditions Fig. 2 with image from Ping et al., 2014
notochord curved ventral, abnormal WT + MO1-mettl3 + MO1-wtap standard conditions Fig. 2 with image from Ping et al., 2014
head decreased size, abnormal WT + MO1-mettl3 + MO1-wtap standard conditions Fig. 2 with image from Ping et al., 2014
apoptotic process increased process quality, abnormal WT + MO1-mettl3 + MO1-wtap standard conditions Fig. 2 with image from Ping et al., 2014
OTHER MO1-mettl3 MORPHOLINO PAGESNo links to external sites
CITATIONS (2)