Morpholino

MO1-dtx1

ID
ZDB-MRPHLNO-130503-1
Name
MO1-dtx1
Previous Names
None
Target
Sequence
5' - TTATCGACCCAGCTCACACAAGGGC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-dtx1
Expressed Gene Anatomy Figures
gapdh Fig. 6 with image from Cheng et al., 2015
her2 Fig. 7 with image from Cheng et al., 2015
her8a Fig. 7 with image from Cheng et al., 2015
mag Fig. 6 with image from Cheng et al., 2015
neurog1 Fig. 5 with image from Cheng et al., 2015
slc1a3a Fig. 6 with image from Cheng et al., 2015
Phenotype
Phenotype resulting from MO1-dtx1
Phenotype Fish Figures
brain neuroblast neurog1 expression decreased amount, abnormal TU + MO1-dtx1 Fig. 5 with image from Cheng et al., 2015
forebrain neuroblast neurog1 expression decreased amount, abnormal TU + MO1-dtx1 Fig. 5 with image from Cheng et al., 2015
glial cell gapdh expression decreased amount, abnormal TU + MO1-dtx1 Fig. 6 with image from Cheng et al., 2015
glial cell mag expression decreased amount, abnormal TU + MO1-dtx1 Fig. 6 with image from Cheng et al., 2015
glial cell decreased amount, abnormal TU + MO1-dtx1 Fig. 6 with image from Cheng et al., 2015
glioblast slc1a3a expression decreased amount, abnormal TU + MO1-dtx1 Fig. 6 with image from Cheng et al., 2015
hindbrain neuroblast neurog1 expression decreased amount, abnormal TU + MO1-dtx1 Fig. 5 with image from Cheng et al., 2015
nervous system her8a expression increased amount, abnormal TU + MO1-dtx1 Fig. 7 with image from Cheng et al., 2015
nervous system her2 expression increased amount, abnormal TU + MO1-dtx1 Fig. 7 with image from Cheng et al., 2015
neuroblast neurog1 expression decreased amount, abnormal TU + MO1-dtx1 Fig. 5 with image from Cheng et al., 2015
neuron differentiation decreased occurrence, abnormal TU + MO1-dtx1 Fig. 5 with image from Cheng et al., 2015
spinal cord neuroblast neurog1 expression decreased amount, abnormal TU + MO1-dtx1 Fig. 5 with image from Cheng et al., 2015
whole organism gapdh expression decreased amount, abnormal TU + MO1-dtx1 Fig. 6 with image from Cheng et al., 2015
whole organism slc1a3a expression decreased amount, abnormal TU + MO1-dtx1 Fig. 6 with image from Cheng et al., 2015
whole organism neurog1 expression decreased amount, abnormal TU + MO1-dtx1 Fig. 5 with image from Cheng et al., 2015
whole organism her8a expression increased amount, abnormal TU + MO1-dtx1 Fig. 7 with image from Cheng et al., 2015
whole organism her2 expression increased amount, abnormal TU + MO1-dtx1 Fig. 7 with image from Cheng et al., 2015
Phenotype of all Fish created by or utilizing MO1-dtx1
Phenotype Fish Conditions Figures
forebrain neuroblast neurog1 expression decreased amount, abnormal TU + MO1-dtx1 standard conditions Fig. 5 with image from Cheng et al., 2015
spinal cord neuroblast neurog1 expression decreased amount, abnormal TU + MO1-dtx1 standard conditions Fig. 5 with image from Cheng et al., 2015
nervous system her8a expression increased amount, abnormal TU + MO1-dtx1 standard conditions Fig. 7 with image from Cheng et al., 2015
glial cell mag expression decreased amount, abnormal TU + MO1-dtx1 standard conditions Fig. 6 with image from Cheng et al., 2015
whole organism her8a expression increased amount, abnormal TU + MO1-dtx1 standard conditions Fig. 7 with image from Cheng et al., 2015
nervous system her2 expression increased amount, abnormal TU + MO1-dtx1 standard conditions Fig. 7 with image from Cheng et al., 2015
whole organism gapdh expression decreased amount, abnormal TU + MO1-dtx1 standard conditions Fig. 6 with image from Cheng et al., 2015
whole organism her2 expression increased amount, abnormal TU + MO1-dtx1 standard conditions Fig. 7 with image from Cheng et al., 2015
neuroblast neurog1 expression decreased amount, abnormal TU + MO1-dtx1 standard conditions Fig. 5 with image from Cheng et al., 2015
glial cell gapdh expression decreased amount, abnormal TU + MO1-dtx1 standard conditions Fig. 6 with image from Cheng et al., 2015
brain neuroblast neurog1 expression decreased amount, abnormal TU + MO1-dtx1 standard conditions Fig. 5 with image from Cheng et al., 2015
whole organism slc1a3a expression decreased amount, abnormal TU + MO1-dtx1 standard conditions Fig. 6 with image from Cheng et al., 2015
glioblast slc1a3a expression decreased amount, abnormal TU + MO1-dtx1 standard conditions Fig. 6 with image from Cheng et al., 2015
neuron differentiation decreased occurrence, abnormal TU + MO1-dtx1 standard conditions Fig. 5 with image from Cheng et al., 2015
hindbrain neuroblast neurog1 expression decreased amount, abnormal TU + MO1-dtx1 standard conditions Fig. 5 with image from Cheng et al., 2015
whole organism neurog1 expression decreased amount, abnormal TU + MO1-dtx1 standard conditions Fig. 5 with image from Cheng et al., 2015
glial cell decreased amount, abnormal TU + MO1-dtx1 standard conditions Fig. 6 with image from Cheng et al., 2015
convergent extension involved in axis elongation occurrence, ameliorated AB/EKW + MO1-dtx1 + MO4-bbs4 standard conditions Fig. S4 from Tsai et al., 2019
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.