header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-121127-5
Morpholino Name: MO1-mpi
Target: mpi (1)
Sequence:
5' - GAGGAAACACTTTCACTTCCGCCAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-mpi No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-mpi
Expressed Gene Anatomy Figures
gfpt1 Fig. 6 with image from DeRossi et al., 2017
tp53 Fig. 3 with imageFig. 6 with imageFig. 7 from DeRossi et al., 2017
PHENOTYPE
Phenotype resulting from MO1-mpi
Phenotype Figures
apoptotic process increased occurrence, abnormal Fig. 3 with image from DeRossi et al., 2017
apoptotic process process quality, ameliorated Fig. 3 with image from DeRossi et al., 2017
dolichol-linked oligosaccharide biosynthetic process disrupted, abnormal Fig. 2 with image from Chu et al., 2013
eye decreased size, abnormal Fig. 3 with imageFig. 6 with image from DeRossi et al., 2017
Fig. 3 with image from Chu et al., 2013
eye size, ameliorated Fig. 3 with image from DeRossi et al., 2017
forebrain decreased size, abnormal Fig. 3 with image from Chu et al., 2013
glycolytic process decreased process quality, abnormal Fig. 5 from DeRossi et al., 2017
head decreased size, abnormal Fig. 3 with imageFig. 6 with image from DeRossi et al., 2017
head size, ameliorated Fig. 3 with image from DeRossi et al., 2017
lipooligosaccharide catabolic process increased occurrence, abnormal Fig. 6 from Cline et al., 2012
liver decreased size, abnormal Fig. 3 with imageFig. 6 with image from DeRossi et al., 2017
Fig. 3 with image from Chu et al., 2013
liver size, ameliorated Fig. 3 with image from DeRossi et al., 2017
mandibular arch skeleton malformed, abnormal Fig. 3 with image from Chu et al., 2013
mandibular arch skeleton morphology, abnormal Fig. 3 with imageFig. 6 with image from DeRossi et al., 2017
mandibular arch skeleton morphology, ameliorated Fig. 3 with image from DeRossi et al., 2017
oligosaccharide-lipid intermediate biosynthetic process disrupted, abnormal Fig. 2 with image from Chu et al., 2013
pericardium edematous, abnormal Fig. 3 with imageFig. 6 with image from DeRossi et al., 2017
Fig. 3 with image from Chu et al., 2013
pericardium edematous, ameliorated Fig. 3 with image from DeRossi et al., 2017
post-vent region curved, abnormal Fig. 3 with image from Chu et al., 2013
whole organism tp53 expression amount, ameliorated Fig. 3 with image from DeRossi et al., 2017
whole organism dead, abnormal Fig. 1 with image from Chu et al., 2013
whole organism decreased life span, abnormal Fig. 3 with image from DeRossi et al., 2017
whole organism Ab1-ogt labeling increased amount, abnormal Fig. 7 from DeRossi et al., 2017
whole organism gfpt1 expression increased amount, abnormal Fig. 6 with image from DeRossi et al., 2017
whole organism tp53 expression increased amount, abnormal Fig. 3 with imageFig. 6 with imageFig. 7 from DeRossi et al., 2017
whole organism Ab2-ogt labeling increased amount, abnormal Fig. 7 from DeRossi et al., 2017
whole organism life span, ameliorated Fig. 3 with image from DeRossi et al., 2017
whole organism lactate decreased amount, abnormal Fig. 5 from DeRossi et al., 2017

Phenotype of all Fish created by or utilizing MO1-mpi
Phenotype Fish Conditions Figures
glycolytic process decreased process quality, abnormal AB + MO1-mpi standard conditions Fig. 5 from DeRossi et al., 2017
whole organism tp53 expression increased amount, abnormal AB + MO1-mpi standard conditions Fig. 3 with imageFig. 6 with imageFig. 7 from DeRossi et al., 2017
whole organism Ab1-ogt labeling increased amount, abnormal AB + MO1-mpi standard conditions Fig. 7 from DeRossi et al., 2017
whole organism dead, abnormal AB + MO1-mpi standard conditions Fig. 1 with image from Chu et al., 2013
post-vent region curved, abnormal AB + MO1-mpi standard conditions Fig. 3 with image from Chu et al., 2013
apoptotic process increased occurrence, abnormal AB + MO1-mpi standard conditions Fig. 3 with image from DeRossi et al., 2017
whole organism tp53 expression amount, ameliorated AB + MO1-mpi chemical treatment: 6-diazo-5-oxo-L-norleucine Fig. 6 with image from DeRossi et al., 2017
eye decreased size, abnormal AB + MO1-mpi control Fig. 3 with imageFig. 6 with image from DeRossi et al., 2017
Fig. 3 with image from Chu et al., 2013
liver decreased size, abnormal AB + MO1-mpi control Fig. 3 with imageFig. 6 with image from DeRossi et al., 2017
mandibular arch skeleton morphology, ameliorated AB + MO1-mpi chemical treatment: 6-diazo-5-oxo-L-norleucine Fig. 6 with image from DeRossi et al., 2017
whole organism tp53 expression amount, ameliorated AB + MO1-mpi chemical treatment: OSMI-1 Fig. 7 from DeRossi et al., 2017
whole organism gfpt1 expression increased amount, abnormal AB + MO1-mpi control Fig. 6 with image from DeRossi et al., 2017
whole organism Ab2-ogt labeling increased amount, abnormal AB + MO1-mpi control Fig. 7 from DeRossi et al., 2017
head size, ameliorated AB + MO1-mpi chemical treatment: 6-diazo-5-oxo-L-norleucine Fig. 6 with image from DeRossi et al., 2017
whole organism Ab2-ogt labeling amount, ameliorated AB + MO1-mpi chemical treatment: OSMI-1 Fig. 7 from DeRossi et al., 2017
head decreased size, abnormal AB + MO1-mpi control Fig. 3 with imageFig. 6 with image from DeRossi et al., 2017
mandibular arch skeleton morphology, abnormal AB + MO1-mpi standard conditions Fig. 3 with imageFig. 6 with image from DeRossi et al., 2017
forebrain decreased size, abnormal AB + MO1-mpi standard conditions Fig. 3 with image from Chu et al., 2013
eye size, ameliorated AB + MO1-mpi chemical treatment: 6-diazo-5-oxo-L-norleucine Fig. 6 with image from DeRossi et al., 2017
pericardium edematous, abnormal AB + MO1-mpi standard conditions Fig. 3 with imageFig. 6 with image from DeRossi et al., 2017
Fig. 3 with image from Chu et al., 2013
whole organism Ab1-ogt labeling amount, ameliorated AB + MO1-mpi chemical treatment: 6-diazo-5-oxo-L-norleucine Fig. 7 from DeRossi et al., 2017
whole organism lactate decreased amount, abnormal AB + MO1-mpi standard conditions Fig. 5 from DeRossi et al., 2017
whole organism decreased life span, abnormal AB + MO1-mpi standard conditions Fig. 3 with image from DeRossi et al., 2017
oligosaccharide-lipid intermediate biosynthetic process disrupted, abnormal AB + MO1-mpi standard conditions Fig. 2 with image from Chu et al., 2013
pericardium edematous, ameliorated AB + MO1-mpi chemical treatment: 6-diazo-5-oxo-L-norleucine Fig. 6 with image from DeRossi et al., 2017
liver size, ameliorated AB + MO1-mpi chemical treatment: 6-diazo-5-oxo-L-norleucine Fig. 6 with image from DeRossi et al., 2017
mandibular arch skeleton malformed, abnormal AB + MO1-mpi standard conditions Fig. 3 with image from Chu et al., 2013
dolichol-linked oligosaccharide biosynthetic process disrupted, abnormal AB + MO1-mpi standard conditions Fig. 2 with image from Chu et al., 2013
apoptotic process process quality, ameliorated AB + MO1-mpi + MO4-tp53 standard conditions Fig. 3 with image from DeRossi et al., 2017
eye size, ameliorated AB + MO1-mpi + MO4-tp53 standard conditions Fig. 3 with image from DeRossi et al., 2017
pericardium edematous, ameliorated AB + MO1-mpi + MO4-tp53 standard conditions Fig. 3 with image from DeRossi et al., 2017
mandibular arch skeleton morphology, ameliorated AB + MO1-mpi + MO4-tp53 standard conditions Fig. 3 with image from DeRossi et al., 2017
whole organism life span, ameliorated AB + MO1-mpi + MO4-tp53 standard conditions Fig. 3 with image from DeRossi et al., 2017
head size, ameliorated AB + MO1-mpi + MO4-tp53 standard conditions Fig. 3 with image from DeRossi et al., 2017
liver size, ameliorated AB + MO1-mpi + MO4-tp53 standard conditions Fig. 3 with image from DeRossi et al., 2017
whole organism tp53 expression amount, ameliorated AB + MO1-mpi + MO4-tp53 standard conditions Fig. 3 with image from DeRossi et al., 2017
lipooligosaccharide catabolic process increased occurrence, abnormal WT + MO1-mpi standard conditions Fig. 6 from Cline et al., 2012
liver decreased size, abnormal gz15Tg + MO1-mpi standard conditions Fig. 3 with image from Chu et al., 2013
whole organism lactate amount, ameliorated tp53zdf1/zdf1 + MO1-mpi standard conditions Fig. 5 from DeRossi et al., 2017
eye size, ameliorated tp53zdf1/zdf1 + MO1-mpi standard conditions Fig. 3 with image from DeRossi et al., 2017
glycolytic process process quality, ameliorated tp53zdf1/zdf1 + MO1-mpi standard conditions Fig. 5 from DeRossi et al., 2017
pericardium edematous, ameliorated tp53zdf1/zdf1 + MO1-mpi standard conditions Fig. 3 with image from DeRossi et al., 2017
mandibular arch skeleton morphology, ameliorated tp53zdf1/zdf1 + MO1-mpi standard conditions Fig. 3 with image from DeRossi et al., 2017
whole organism life span, ameliorated tp53zdf1/zdf1 + MO1-mpi standard conditions Fig. 3 with image from DeRossi et al., 2017
liver size, ameliorated tp53zdf1/zdf1 + MO1-mpi standard conditions Fig. 3 with image from DeRossi et al., 2017
head size, ameliorated tp53zdf1/zdf1 + MO1-mpi standard conditions Fig. 3 with image from DeRossi et al., 2017
whole organism tp53 expression amount, ameliorated AB + MO1-gfpt1 + MO1-mpi control Fig. 6 with image from DeRossi et al., 2017
whole organism gfpt1 expression amount, ameliorated AB + MO1-gfpt1 + MO1-mpi control Fig. 6 with image from DeRossi et al., 2017
whole organism tp53 expression amount, ameliorated AB + MO1-mpi + MO1-ogt.1 standard conditions Fig. 7 from DeRossi et al., 2017
whole organism Ab1-ogt labeling amount, ameliorated AB + MO1-mpi + MO1-ogt.1 standard conditions Fig. 7 from DeRossi et al., 2017
whole organism Ab2-ogt labeling amount, ameliorated AB + MO1-mpi + MO1-ogt.1 control Fig. 7 from DeRossi et al., 2017
thigmotaxis decreased process quality, abnormal WT + MO1-mpi + MO2-pmm2 standard conditions Fig. 8 from Cline et al., 2012
swimming behavior decreased process quality, abnormal WT + MO1-mpi + MO2-pmm2 standard conditions Fig. 8 from Cline et al., 2012
Genome Resources:
CITATIONS (4)