ZFIN ID: ZDB-MRPHLNO-111222-1
Morpholino Name: MO1-ush1c
Target: ush1c (1)
Sequence:
5' - TAGAATTGAGACTTACTGATGGTAC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-ush1c No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-ush1c
Expressed Gene Anatomy Figures
ush1c Fig. 3 with imageFig. 4 with imageFig. 5 with image from Phillips et al., 2011
PHENOTYPE
transcript withdrawn Data in this section is temporarily unavailable, please reload in a few minutes.
OTHER MO1-ush1c MORPHOLINO PAGESNo links to external sites
CITATIONS (1)