ZFIN ID: ZDB-MRPHLNO-111222-1
Morpholino Name: MO1-ush1c
Target: ush1c (1)
Sequence:
5' - TAGAATTGAGACTTACTGATGGTAC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-ush1c No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-ush1c
Expressed Gene Anatomy Figures
ush1c hair cell anterior macula kinocilium, Muller cell, otic sensory epithelium Fig. 3 with imageFig. 4 with imageFig. 5 with image from Phillips et al., 2011
PHENOTYPE 
Phenotype resulting from MO1-ush1c
Phenotype Figures
auditory receptor cell kinocilium absent, abnormal Fig. 4 with image from Phillips et al., 2011
auditory receptor cell kinocilium bent, abnormal Fig. 3 with image from Phillips et al., 2011
auditory receptor cell stereocilium bundle splayed, abnormal Fig. 3 with image from Phillips et al., 2011
detection of light stimulus involved in visual perception disrupted, abnormal text only from Phillips et al., 2011
hair cell anterior macula decreased amount, abnormal Fig. 3 with image from Phillips et al., 2011
hair cell posterior macula decreased amount, abnormal Fig. 3 with image from Phillips et al., 2011
optomotor response disrupted, abnormal Fig. 2 with image from Phillips et al., 2011
postsynaptic density assembly disrupted, abnormal Fig. 7 with image from Phillips et al., 2011
retinal cone cell cytoskeleton of presynaptic active zone detached from retinal outer plexiform layer postsynaptic density, abnormal Fig. 7 with image from Phillips et al., 2011
retinal outer plexiform layer synapse disorganized, abnormal Fig. 7 with image from Phillips et al., 2011
startle response disrupted, abnormal Fig. 2 with image from Phillips et al., 2011
synapse assembly disrupted, abnormal Fig. 7 with image from Phillips et al., 2011

Phenotype of all Fish created by or utilizing MO1-ush1c
Phenotype Fish Conditions Figures
auditory receptor cell kinocilium absent, abnormal ush1cfh293/fh293 + MO1-ush1c standard conditions Fig. 4 with image from Phillips et al., 2011
postsynaptic density assembly disrupted, abnormal AB + MO1-ush1c standard conditions Fig. 7 with image from Phillips et al., 2011
detection of light stimulus involved in visual perception disrupted, abnormal AB + MO1-ush1c standard conditions text only from Phillips et al., 2011
retinal outer plexiform layer synapse disorganized, abnormal AB + MO1-ush1c standard conditions Fig. 7 with image from Phillips et al., 2011
retinal cone cell cytoskeleton of presynaptic active zone detached from retinal outer plexiform layer postsynaptic density, abnormal AB + MO1-ush1c standard conditions Fig. 7 with image from Phillips et al., 2011
synapse assembly disrupted, abnormal AB + MO1-ush1c standard conditions Fig. 7 with image from Phillips et al., 2011
auditory receptor cell kinocilium bent, abnormal WT + MO1-ush1c standard conditions Fig. 3 with image from Phillips et al., 2011
hair cell anterior macula decreased amount, abnormal WT + MO1-ush1c standard conditions Fig. 3 with image from Phillips et al., 2011
hair cell posterior macula decreased amount, abnormal WT + MO1-ush1c standard conditions Fig. 3 with image from Phillips et al., 2011
startle response disrupted, abnormal WT + MO1-ush1c standard conditions Fig. 2 with image from Phillips et al., 2011
optomotor response disrupted, abnormal WT + MO1-ush1c standard conditions Fig. 2 with image from Phillips et al., 2011
auditory receptor cell stereocilium bundle splayed, abnormal WT + MO1-ush1c standard conditions Fig. 3 with image from Phillips et al., 2011
OTHER MO1-ush1c MORPHOLINO PAGESNo links to external sites
CITATIONS (1)