header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-111222-1
Morpholino Name: MO1-ush1c
Target: ush1c (1)
Sequence:
5' - TAGAATTGAGACTTACTGATGGTAC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-ush1c No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-ush1c
Expressed Gene Anatomy Figures
ush1c Fig. 3 with imageFig. 4 with imageFig. 5 with image from Phillips et al., 2011
PHENOTYPE
Phenotype resulting from MO1-ush1c
Phenotype of all Fish created by or utilizing MO1-ush1c
Phenotype Fish Conditions Figures
auditory receptor cell kinocilium absent, abnormal ush1cfh293/fh293 + MO1-ush1c standard conditions Fig. 4 with image from Phillips et al., 2011
detection of light stimulus involved in visual perception disrupted, abnormal AB + MO1-ush1c standard conditions text only from Phillips et al., 2011
postsynaptic density assembly disrupted, abnormal AB + MO1-ush1c standard conditions Fig. 7 with image from Phillips et al., 2011
retinal outer plexiform layer synapse disorganized, abnormal AB + MO1-ush1c standard conditions Fig. 7 with image from Phillips et al., 2011
retinal cone cell cytoskeleton of presynaptic active zone detached from retinal outer plexiform layer postsynaptic density, abnormal AB + MO1-ush1c standard conditions Fig. 7 with image from Phillips et al., 2011
synapse assembly disrupted, abnormal AB + MO1-ush1c standard conditions Fig. 7 with image from Phillips et al., 2011
auditory receptor cell kinocilium bent, abnormal WT + MO1-ush1c standard conditions Fig. 3 with image from Phillips et al., 2011
hair cell anterior macula decreased amount, abnormal WT + MO1-ush1c standard conditions Fig. 3 with image from Phillips et al., 2011
hair cell posterior macula decreased amount, abnormal WT + MO1-ush1c standard conditions Fig. 3 with image from Phillips et al., 2011
startle response disrupted, abnormal WT + MO1-ush1c standard conditions Fig. 2 with image from Phillips et al., 2011
optomotor response disrupted, abnormal WT + MO1-ush1c standard conditions Fig. 2 with image from Phillips et al., 2011
auditory receptor cell stereocilium bundle splayed, abnormal WT + MO1-ush1c standard conditions Fig. 3 with image from Phillips et al., 2011
OTHER MO1-ush1c MORPHOLINO PAGESNo links to external sites
CITATIONS (1)