header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-100503-3
Morpholino Name: MO4-vsx2
Target: vsx2 (1)
Previous Name: vsx2aSPMO2 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - AGGCATGTACCCCGTACCTGAGCTG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice blocking MO, targets exon 1/intron 1 boundary.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO4-vsx2 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO4-vsx2 No data available
PHENOTYPE
Phenotype resulting from MO4-vsx2
No data available

Phenotype of all Fish created by or utilizing MO4-vsx2
OTHER MO4-vsx2 MORPHOLINO PAGES No links to external sites
CITATIONS (1)